Рибосомы и биосинтез белка для ВУЗов

Формат документа: pdf
Размер документа: 2.37 Мб




Прямая ссылка будет доступна
примерно через: 45 сек.



  • Сообщить о нарушении / Abuse
    Все документы на сайте взяты из открытых источников, которые размещаются пользователями. Приносим свои глубочайшие извинения, если Ваш документ был опубликован без Вашего на то согласия.

А.С.Спирин

МОЛЕКУЛЯРНАЯ

БИОЛОГИЯ

Структура

рибосомы

и биосинтез

белка

Допущено

Министерством
высшего
и среднего

специального образования
СССР

в качестве учебника для студентов

биологических специальностей

высших учебных заведений

Москва

«Высшая школа»
1986

ББК
28.070

С
72

УДК
576.8

Рецензенты:

кафедра
биохимии Киевского государственного университета

им. Т. Г. Шевченко (зав. кафедрой проф. Н. Е. Кучеренко);

и
филиал кафедры биохимии при Институте молекулярной биологии

и
генетики АН УССР (зав. филиалом кафедры биохимии,

акад.
АН
УССР,
проф. Г. X. Мацука);

акад.
Д. Г. Кнорре (зав. кафедрой молекулярной биологии

Новосибирского
государственного университета

им. Ленинского комсомола)

Спирин
А. С.

С72 Молекулярная биология: Структура рибосомы
и
биосинтез

белка: Учеб.
для
студентов биол. спец. вузов.
—М.:
Высш.
шк.,

1986.-303
с; ил.

В
учебнике освещается современное состояние проблемы биосинтеза белка. Изложены

сведения
о структуре рибосомы, рибонуклеиновых кислотах, обеспечивающих ее функцио-

нирование, рибосомных белках, рассмотрены механизмы трансляции и ее регуляции.

«KW-*
- - ББК м;™

1
Издательство «Высшая школа», 1986

Предисловие

Молекулярная биология занимает -особое место
в
развитии науки

второй половины
XX в.
Именно
ее
рождение
и
последующий

бурный рост выдвинули биологию
в
целом
в
ряды самых

передовых
и
популярных наук,
а XX в.
стали иногда называть

«веком биологии». Возникнув
как
отрасль биохимии, молекуляр-

ная
биология получила мощное развитие благодаря внедрению

в
нее
идей
и
методов генетики
и
физики.
Открытый
и
сформули-

рованный
в 1953 г.
принцип комплементарное™
в
нуклеиновых

кислотах, объяснив особенности
структуры
этих макромолекуляр-

ных соединений
и
обладая предсказательной силой
в
отношении

их функций,
лег в
основу нового направления науки. Огромное

научное
и
методологическое значение молекулярной биологии

состояло
в том, что
наиболее фундаментальное
и
таинственное

свойство живой материи — воспроизведение
себе
подобного —

оказалось возможным объяснить
на
молекулярном уровне.
Мо-

лекулярная
структура
вещества,
в
котором записана (закодиро-

вана) генетическая информация, механизмы
воспроизведения ге-

нетической информации
в
поколениях клеток
и
организмов
и

механизмы
реализации
генетической информации через биосинтез

белков —вот
три
направления,
по
которым развивалась
эта
наука

и
где
были сделаны решающие
успехи.
Кроме того,
структура

и
механизмы функционирования белков стали также предметом

молекулярной биологии.

Становление
и
развитие молекулярной биологии имело боль-

шие
последствия. Прежде всего,
ее
грандиозные достижения

и
стремительность роста привлекли внимание всего человечества

к
биологии
и
биологическим проблемам. Далее,
по
своему

существу,
все достижения молекулярной биологии
явились
полным

торжеством материалистического мировоззрения. Молекулярная

3

биология,
сама
будучи
чисто фундаментальной наукой, привела

к
возникновению многообещающей прикладной отрасли — генной

инженерии.

В Советском Союзе молекулярная биология имела свою

предысторию с серьезными научными заделами и традициями.

Первые конкретные идеи о матричном механизме воспроизве-

дения
макромолекулярных хромосомных
структур
как носителей

наследственности были высказаны еще в 1928 г. Н. К. Коль-

цовым.
В 1934 г. в Московском государственном университете

им.
М. В. Ломоносова на кафедре биохимии растений под

руководством А. Р. Кизеля были начаты исследования нуклеи-

новых кислот. Эти работы затем возглавил его ученик А. Н. Бе-

лозерский,
трудами
которого была доказана универсальность

распространения
ДНК в живом мире и связь количественного

содержания нуклеиновых кислот в клетках с интенсивностью

роста и размножения. К моменту «официального» рождения

молекулярной биологии в 1953 г., когда Дж. Уотсоном и Ф. Кри-

ком
был сформулирован принцип
структуры
и воспроизведения

ДНК,
у нас в стране существовала собственная школа специа-

листов по нуклеиновым кислотам, готовая воспринять тенденции

развития этой новой науки. Поэтому уже в ранний период

становления
молекулярной биологии, несмотря на определенные

трудности и недостаток кадров, советскими учеными был сделан

ряд принципиальных научных вкладов, среди которых обнару-

жение специальной фракции РНК, в последующем названной

информационной
РНК
(мРНК),
открытие временной регуляции

синтеза информационных РНК на ДНК, пионерские исследова-

ния
информационных РНК эукариотических клеток, расшифровка

полной
первичной
структуры
одной из
тРНК,
демонстрация

возможности самосборки рибосом и т. д.

Опираясь
на быстро растущий объем знаний в области мо-

лекулярной биологии, отечественные традиции в исследовании

нуклеиновых кислот и собственный опыт работы, автор данного

учебника подготовил в 1964 г. и начал чтение курса лекций

по
молекулярной биологии в Московском государственном уни-

верситете. Конечно, с течением времени курс эволюционировал

и
расширялся, и теперь он состоит из
трех
частей («Строение

и
биосинтез нуклеиновых кислот»,
«Структура
рибосом и био-

синтез
белков»
и
«Структура
и функции белков»). В основу

предлагаемой книги положена та часть курса лекций, которая

посвящена
структуре
рибосом и биосинтезу белка.

Первоочередное издание именно этой части курса молекуляр-

ной
биологии диктуется рядом обстоятельств. Главное —это

отсутствие хорошего учебника или монографии не только в

отечественной, но и в мировой литературе, где вопросы строе-

ния
белоксинтезирующего аппарата и механизмы биосинтеза белка

были бы освещены достаточно подробно и на современном

уровне. В отношении строения и биосинтеза нуклеиновых кислот,

механизмов редупликации и транскрипции такие учебники име-

ются, и среди них прекрасная книга Дж. Уотсона «Молекуляр-

ная
биология
гена»
(М., Мир, 1978) и учебник Б. Левина
«Гены»,

изданный
в США (В. Lewin. Genes. John
Wiley
and Sons,
N.-Y.,

1983). Правда, учебник по структуре и функции белков тоже

отсутствует,
но недавно вышла книга (Г. Е. Шульц, Р. X. Шир-

мер.
Принципы структурной организации белков. М., Мир, 1982),

которая
по крайней мере частично восполняет этот пробел.

Предлагаемый учебник написан в строгом соответствии с про-

граммой курса по молекулярной биологии, читаемого в Мос-

ковском
государственном университете им. М. В. Ломоносова,

но
охватывает всего часть (приблизительно, одну треть) общего

курса. Книга может рассматриваться также как пособие для

подготовки кандидатского минимума по молекулярной биологии

и
соответствует программе, утвержденной ВАК. Однако, кроме

изложения
наиболее фундаментальных
знаний,
которые
накоп-

лены
в рассматриваемой области, в книгу включен также и ряд

еще не устоявшихся, а иногда и спорных интерпретаций и

положений,
как примеры возможных, с точки зрения сегодняш-

него дня, представлений. В ряде случаев автор предпочел давать

предположительную трактовку спорным и противоречивым дан-

ным,
чем оставлять белые пятна в этих местах, надеясь, что

это
поможет читателям думать, обсуждать и строить свои

• гипотезы.

Каждая
глава книги снабжена списком рекомендованной ли-

тературы, которая включает два типа источников. Чтобы дать

возможность читателю восстановить логику открытий, приведены

пионерские
работы в данной области. Для расширения пред-

ставлений и углубления знаний по отдельным вопросам в списке

литературы даются обзоры и ряд фундаментальных статей по-

следних лет.

Хотелось бы указать на одну трудность формального ха-

рактера, с которой пришлось столкнуться при написании книги.

Дело в том, что в отечественной биохимической литературе

5

все еще нет устоявшейся системы буквенных сокращений це-

лого ряда соединений, и, в частности, некоторых специальных

белков, нуклеиновых кислот и нуклеотидов; для некоторых

оставлена латинская (англо-американская) символика

EF-G,
IF-2

и
т. д., для
других
давно используется русская

мРНК,
тРНК,

ДНК,
а для третьих обе

АТР или АТФ, poly(U) или полиУ

и
т. п. Трудности возникают при написании уравнений, комп-

лексов и смесей, где фигурируют и те, для которых принята

русская символика, и те, которые пишутся только латинскими

буквами. Пришлось
всюду
в написании уравнений, комплексов

и
смесей придерживаться единой—латинской

символики,
и
лишь

по
тексту сохранить возможно больше русских обозначений.

Иллюстрирование учебного курса представляет собой, пожа-

луй, наиболее сложную и ответственную
задачу.
В данной книге

автор постарался не воспроизводить стандартные схемы и ри-

сунки из
других
учебников, обзоров и монографий, а сделать

свои. В окончательном изготовлении схематических рисунков,

которые были приготовлены в виде эскизов, оказал огромную

помощь Отдел научной информации (зав. А. Г. Райхер) Института

белка АН
СССР;
автор особенно признателен П. В. Завозиной

и
В. И. Невской за выполнение чертежных работ. Иллюстри-

рование книги рисунками стереохимических моделей и ориги-

нальными электронными микрофотографиями было бы невозмож-

но
без непосредственного участия сотрудников Института белка

АН
СССР
В. И. Лима и В. Д. Васильева. Более того, они

были постоянными консультантами при написании соответству-

ющих разделов. Молодые сотрудники института Андрей Каява,

Дмитрий Ляхов, Ольга Селиванова и Сергей Рязанцев также

внесли свой
труд
в рисование и фотографирование.

Автор
очень признателен целому ряду коллег, особенно

В. И.
Аголу.
А. А. Богданову, Л. А. Воронину, А. С. Гир-

шовичу, А. Т.
Гудкову,
А. В. Ефимову, Л. Л. Киселеву,

Н.
А. Киселеву, Д. Г. Кнорре, А. А. Краевскому, М. К. Куха-

новой,
О. Б. Птицыну, Е. И. Шахновичу и В. С. Шварцу,

сделавшим ценные замечания по отдельным разделам рукописи.

Хотелось бы поблагодарить также Л. А. Козлову, Т. Б. Кувшин-

кину, Р. Ф. Макарову, Л. Н. Рожанскую и М. С. Шелестову

за большой организационный и технический вклад в подготовку

рукописи к изданию.
Автор
заранее благодарен всем, кто пришлет

свои замечания и пожелания для улучшения книги.

Академик
А. С
Спирин

Вводная

Глава
I

ОБЩАЯ
СХЕМА
БИОСИНТЕЗА
БЕЛКА

Во
всех
живых клетках белки синтезируются
рибосомами.
Рибосома

представляет собой крупную макромолекулу
со
сложной асимметрич-

ной
четвертичной структурой, построенной
из
рибонуклеиновых

кислот
(рибосомных
РНК)
и
белков.
Для
того
чтобы синтезировать

белок, рибосома должна быть снабжена
а)
программой, задающей

порядок
чередования аминокислотных остатков
в
полипептидной

цепи
белка;
б)
аминокислотным материалом,
из
которого надлежит

строить белок;
в)
энергией. Сама рибосома
обладает
каталитической

(энзиматической)
функцией,
ответственной за образование пептидных

связей
и,
соответственно, полимеризацию аминокислотных остатков

в
полипептидную цепь белка.

Программа, задающая порядок чередования аминокислотных

остатков
в
полипептидной цепи белка,
исходит
от
дезоксирибонук-

леиновой
кислоты
(ДНК),
т.
е.
из
генома клетки. Отдельные участки

двутяжевой
ДНК,
называемые
генами,
являются матрицами для синте-

за на них однотяжевых цепей
РНК.
Синтезированные цепи РНК ком-

плементарны одной из цепей ДНК и, таким
образом,
точно воспроиз-

водят дезоксирибонуклеотидную последовательность
другой
цепи

ДНК
в
своей рибонуклеотидной последовательности. Процесс такого

копирования
гена, осуществляемый ферментом РНК-полимеразой,

получил название
транскрипции.
РНК
в
течение синтеза
и
после него,

особенно
в
эукариотических клетках, может подвергаться
ряду
допол-

нительных изменений, называемых
процессингом,
в
ходе
которых
из

нее
могут
быть вырезаны определенные куски нуклеотидной после-

довательности. Получающаяся РНК поступает
далее
в
рибосомы
в

качестве программы, определяющей аминокислотную последователь-

ность
в
синтезируемом белке.
Она
называется
информационной
или

«мессенджер»
РНК
(мРНК).
Таким образом, именно транскрипция

генов
и
образование
мРНК
обеспечивают поток информации
от

ДНК
к
рибосомам.

Исходным материалом,
из
которого строится белок, являются

аминокислоты.
Однако свободные аминокислоты
не
используются

рибосомой.
Для
того
чтобы
служить
субстратом
для
рибосомы,

аминокислота
должна быть
активирована с
участием
сопряженного

расщепления
АТФ и акцептирована
(ковалентно присоединена)
спе-

7

ДНК

ТРАНСКРИПЦИЯ

/\/\/\/\/\/\/V
РНК

ПРОЦЕССИНГ
И
ТРАНСПОРТ

|
РНК

мРНК

ТРАНСЛЯЦИЯ

РИБОСОМА
РИБОСОМА

РИБОСОМА

••

СВОРАЧИВАНИЕ,

ПРОЦЕССИНГ
И
ТРАНСПОРТ

ПОЛИПЕПТИДА

БЕЛОК

Рис.
1. Общая схема биосинтеза белка
(«ДНК
-•
РНК
-*
белок»)

циальной
молекулой РНК, называемой
трансферной
или
транспорт-

ной
РНК
(тРНК),
с
помощью фермента аминоацил-тРНК-синтетазы.

Получающиеся аминоацил-тРНК поступают
в
рибосому
в
качестве

субстрата
для
синтеза белка. Кроме того, энергия химической связи

между
аминокислотным остатком
и
тРНК
используется
для
реакции

образования пептидной связи
в
рибосоме. Таким образом, активация

аминокислот
и
образование -аминоацил-тРНК обеспечивают поток

как
материала,
так и
энергии
для
рибосомного синтеза белка.

Эти
три потока (информации, материала и энергии) встречаются

в
рибосоме. Воспринимая их, рибосома осуществляет перевод, или

трансляцию,
генетической информации с языка нуклеотидной после-

довательности
мРНК
на язык аминокислотной последовательности

синтезируемой полипептидной цепи белка. Если представить это в

молекулярных терминах, то рибосома последовательно сканирует

цепь
мРНК
(движется вдоль нее) и тоже последовательно выбирает

из
среды аминоацил-тРНК, в
результате
чего специфичность амино-

ацильного остатка выбираемой рибосомой аминоацил-тРНК каждый

раз детерминируется специфичностью комбинации нуклеотидов

считываемого в данный момент рибосомой отрезка
мРНК.
Таким

образом, возникает проблема
генетического
кода:
какие комбинации

нуклеотидов детерминируют, т. е. кодируют,
каждую
из 20 амино-

кислот, из которых строятся молекулы белков?

Движение рибосомы вдоль цепи
мРНК
(или, другими словами,

пропускание цепи
мРНК
сквозь рибосому) задает строгий временной

порядок
вхождения в рибосому разных аминоацил-тРНК в соответ-

ствии с порядком расположения кодирующих нуклеотидных комби-

наций
вдоль
мРНК.
Аминоацильный остаток выбранной аминоацил-

тРНК
каждый раз ковалентно присоединяется рибосомой к растущей

полипептидной
цепи. Деацилированная
тРНК
освобождается из

рибосомы в раствор. Так последовательно, шаг за шагом, строится

полипептидная
цепь белка.

Общая схема биосинтеза белка, изложенная выше, представлена

на
рис. 1.

Рекомендуемая
литература

Живая
клетка:
Пер. с
англ./Под
ред. Г. М.
Франка.
М.: Мир, 1966. С. 51—66.

Уотсон
Дж. Д.
Молекулярная
биология
гена:
Пер. с
англ.
М.: Мир, 1978.

Шульц
Г.,
Ширмер
Р.
Принципы
структурной
организации
белков:
Пер. с
англ./Под

ред. Е. М.
Попова.
М.: Мир, 1982.

Lewin
В.
Genes.
John
Wiley
& Sons, N. Y., 1983.

Глава
II.

ИНФОРМАЦИОННАЯ РНК

И ГЕНЕТИЧЕСКИЙ КОД

1. ОТКРЫТИЕ мРНК

Вскоре после открытия и окончательного признания генетической

Роли
ДНК
(1944-1953)
стало ясно, что ДНК не является непосред-

ственной
матрицей для синтеза полипептидных цепей белков.

С
другой
стороны, целый ряд ранних наблюдений приводил к мысли

о
непосредственной связи РНК с синтезом белков в клетке.

По-видимому, отсюда родилось представление о том, что
РНК
должна

быть посредником, осуществляющим перенос генетической информа-

ции
от ДНК к белкам, и, следовательно, что именно РНК может быть

матрицей
для
полимеризации аминокислотных остатков
(ДНК—•

РНК

белок).

Приблизительно
в то же
самое время были открыты белок-

синтезирующие рибонуклеопротеидные частицы клетки, названные

позднее рибосомами (см.
гл. А.
IV),
и
установлено,
что их
РНК
со-,

ставляет подавляющую часть тотальной клеточной РНК. Поэтому

казалось естественным,
что
гены транскрибируются
в
рибосомные

РНК,
и
именно рибосомные РНК являются матрицами
для
синтеза

белков (гипотеза: «один ген — одна рибосома — один белок»). Чтобы

проверить
эту
гипотезу,
А.
Н. Белозерским
и А.
С. Спириным
в
1956—

1957
гг. был
проведен сравнительный анализ нуклеотидного состава

ДНК
и
РНК
у
широкого
круга
микроорганизмов. Состав ДНК очень

различается
у
разных групп микроорганизмов
и, в
соответствии
с

идеей «ДНК —•
РНК
—• белок», ожидалось,
что
состав тотальной

РНК
будет
варьировать так же, отражая состав
ДНК.
Однако
результат

был полностью неожиданным: несмотря
на
громадные различия
в

составе
ДНК от
вида
к
виду,
состав тотальной
РНК был
похож

у
всех
изученных бактерий
и
не повторял состава
ДНК.
Это наводило

на
мысль,
что
основная масса клеточной РНК, т. е. рибосомная РНК,

не
является прямым посредником
между
ДНК
и
синтезом белков.

В
то же
время проведенные анализы состава РНК показали, что он

не
идентичен
у
разных видов
и
что при больших различиях
в
составе

ДНК
можно заметить небольшой сдвиг в составе
РНК
в
ту
же сторону.

Другими словами, была открыта положительная корреляция составов

ДНК
и
РНК
у
микроорганизмов.
Отсюда
было сделано заключение

о
существовании
в
клетках особой
небольшой фракции
РНК, состав

которой
повторяет состав ДНК
и
которая могла
бы
служить
посред-

ником
между
генами
и
белоксинтезирующими частицами.

Независимо
Э. Волкин
и
Ф.
Астрачан
(1956)
изучали синтез РНК

в
бактериях, зараженных ДНК-содержащим бактериофагом Т2. После

заражения бактерии перестают синтезировать свои белки,
и
весь

белковый синтез клетки переключается
на
продукцию белков фага.

Оказалось,
что
основная часть
РНК
клетки-хозяина
при
этом
не

изменяется,
но в
клетке начинается продукция небольшой фракции

метаболически нестабильной (короткоживущей) РНК, нуклеотидный

состав которой подобен
составу
ДНК фага.

Через несколько
лет, в 1961 г., эта
небольшая фракция
РНК

(ДНК-подобная
РНК) была вычленена
из
общей массы РНК,
а ее

функция
как посредника, переносящего информацию
от
ДНК
к
рибо-

сомам, была продемонстрирована
в
прямых экспериментах С. Бренне-

ра,
Ф.
Жакоба и М. Меселсона, с одной стороны, и
Ф.
Гро и Дж. Уотсо-

на
с
сотр.
с
другой,
а
также
в
опытах С. Спигелмана
с
сотр.

Было
показано,
что
ДНК-подобная
РНК,
образующаяся после инфек-

ции
бактерии фагом
Т4,
связывается
со
старыми хозяйскими рибо-

сомами клетки (новых рибосом после заражения
не
образуется).

Рибосомы,
несущие
эту
РНК, синтезируют фаговые белки.
Эта
РНК

может быть легко отделена
от
рибосом
в
условиях
in
vitro,
без

разрушения рибосом. Она действительно оказалась комплементарной

одной
из
цепей фаговой ДНК.

ю

В том же
году
идею о том, что не стабильная (структурная)

рибосомная
РНК, а специальная короткоживущая информационная

РНК
переносит информацию от генов к рибосомам и является не-

посредственной матрицей для последовательной расстановки амино-

кислот в процессе биосинтеза белка, высказали
Ф.
Жакоб и Ж. Моно

на
основании данных по генетической регуляции у бактерий. Назва-

ние
РНК-посредник
или
информационная
РНК
(messenger
RNА) было

принято
во
всех
последующих исследованиях.

2.
РАСШИФРОВКА
КОДА

После
открытия
мРНК
(1956—1961)
предстояло выяснить тот код,

которым аминокислотная последовательность белков записана в виде

рибонуклеотидной последовательности
мРНК
и, следовательно, в

исходной дезоксирибонуклеотидной последовательности одной из

двух
цепей ДНК.

Априорные соображения уже давно заставляли предполагать, что

каждая аминокислота должна кодироваться, по крайней мере, трипле-

том нуклеотидов. Действительно, имеется 20 природных аминокислот,

из
которых строятся белки (рис. 2). В то же время нуклеиновые

кислоты построены всего из 4 сортов нуклеотидных остатков (см.

рис.
4), их азотистыми основаниями являются аденин (А), гуанин (G),

цитозин
ГС) и либо урацил (U) в РНК, либо тимин (Т) в ДНК.

Ясно,
что один нуклеотид не может кодировать одну аминокислоту

(4 против 20). Возможных динуклеотидных комбинаций
(дуплетов)

может быть 16, что опять-таки недостаточно для кодирования 20 ами-

нокислот.
Следовательно, минимальное количество остатков в нукле-

отидной комбинации, кодирующей одну аминокислоту, может быть

три,
т. е. аминокислоты должны кодироваться, скорее всего,
нукле-

отидными
триплетами.
Общее количество возможных триплетов

составляет 64, что с избытком
хватает
для кодирования 20 амино-

кислот.

Ситуация с избыточными триплетами могла бы быть
двоякой:
либо

только 20 триплетов являются значащими, т. е. кодируют ту или иную

аминокислоту, а остальные 44 бессмысленны, либо аминокислота

может кодироваться более чем одним триплетом, и
тогда
код

является
вырожденным.

Далее, триплетный код мог бы быть либо перекрывающимся, когда

один
и тот же нуклеотид
участвует
в
трех
(сильно перекрывающихся)

и
двух
(менее перекрывающихся) кодирующих триплетах, либо непе-

рекрывающимся, когда в цепи нуклеиновой кислоты независимые

кодирующие триплеты примыкают
друг
к
другу
или
даже
разделены

некодирующими нуклеотидами. Однако тот факт, что точечная
мута-

ция
(изменение одного нуклеотида в цепи нуклеиновой кислоты)

приводит, как правило, к замене только одной аминокислоты в белке,

говорил против идеи перекрывающегося кода. Кроме того, перекры-

вающийся код неизбежно влек бы за собой ограничения в возмож-

ных аминокислотных соседях вдоль полипептидной цепи,
чего
не

11

Нодоны:
Аминокислотные

остатки:
Аминокислотные
Кодоны:

остатни:

UUU1

UUCJ

U U
Al

UUG

CUU

CUC

CUA

CUG
I

L-ФЕНИЛАЛА-
о/[*:">сн2-сн

НИЛ
(Phe)
^н-сн -1

L-ЛЕЙЦИЛ

(Leu)

AUU1

AUC

AUAJ

AUG

GUUl

GUCl

GUAf

GUGJ
L-ИЗОЛЕЙЦИЛ

(He)

L-МЕТИОНИЛ

(Met)

L-ВАЛИЛ

(Val)
L-СЕРИЛ
.

(Ser)
UCU

UCC

UCA

UCG

AGU

AGG

rCCU

L-ПРОЛИЛ
JCCC

L-ТРЕОНИЛ

(Thr)
ACU

ACC

АСА

LACG

fGCU

L-АЛАНИЛ
I
GCC

(Ala)
tggä

Рис.
2. Аминокислотные остатки белков и их кодоны

наблюдалось
из
анализа первичных
структур
белков. Следовательно,

неперекрывающийся
код казался более вероятным.

Наконец,
необходимо было знать, разделены ли значащие трипле-

ты незначащими остатками («запятыми»)
или
триплеты читаются

вдоль цепи подряд,
т.е.
имеет место
код без
запятых.
В
последнем

случае
возникает проблема фазы
или
рамки считывания матричной

цепи
нуклеиновой кислоты: только начало считывания
с
точно

определенной точки полинуклеотидной цепи
и
дальнейшее сканирова-

ние
цепи строго подряд
по
триплетам могло
дать
однозначную

последовательность аминокислот.

Классические эксперименты
Ф.
Крика
и
С. Бреннера
с
сотр.
(1961)

доказали,
что код
является триплетным, вырожденным, неперекры-

12

Кодоны:
Аминокислотные

остатки:
Аминокислотные
Кодоны:

остатки:

UAU"!
L-ТИРОЗИЛ

U
А
С/ (Туг)

CAUl
L-ГИСТИДИЛ

С
А
С/ (His)

САА1
L-ГЛУТАМИНИЛ

CAGJ
(Gin)

AAUl L-АСПАРАГИНИЛ H^

AACJ
(Asn)

AAAl
L-ЛИЗИЛ
H3N-CHrCH2-CH2-CH2

AAGJ
(LyS) 3 2 2 2 2

GAA1
L-ГЛУТАМИЛ

GAGJ
(Glu)
L-ЦИСТЕИНИЛ
Г
U G U

(Cys)
l
U
G
С

L-ТРИПТОФА-
UGG

нил
агр) иее

CGU

(ИЗ
С

CG
А

CGG

AGA

AGG

fGGU

I
G G
С

1GGA

IGGG
ГЛИЦИЛ

(Giy)

L-АСПАРТИЛ
f
G
А
U

(Asp)
l
G
А
С

вающимся,
без запятых. Схема экспериментов состояла в следующем.

С
помощью химических агентов, вызывающих либо вставку,. либо

делецию нуклеотидного остатка при редупликации ДНК (профлавин

и
другие
акридиновые красители), были получены многочисленные

мутанты по определенному гену (ген в области rll) бактериофага Т4.

Вставка или делеция нуклеотида в начальном участке гена приво-

дила к полной
утрате
его экспрессии. Путем рекомбинации ДНК

Различных мутантных фагов в клетках
Escherichia
coli
можно было

получить фенотипические ревертанты, где ген снова экспрессировал-

ся.
Анализ рекомбинантов показал, что экспрессия гена восстанавли-

валась, если недалеко от участка со вставкой вводился участок с

Делецией, или наоборот. Экспрессия гена восстанавливалась также,

13

если недалеко от участка со вставкой (или делецией) вводились

еще две вставки (или, соответственно, делеции). Таким образом,

а) вставка (или делеция) одного нуклеотида в начале кодирующего

участка цепи ДНК приводила, по-видимому, к
утрате
всего последую-

щего кодирующего смысла данного гена (а не к точечной мутации)

вследствие сдвига рамки считывания; б) делеция (или вставка)

вблизи вышеуказанной вставки (или, соответственно, делеции)

восстанавливала кодирующий смысл последующей последователь-

ности,
в гене за счет восстановления рамки считывания после нее, и

в) три, но не менее, близко расположенные вставки (или делеции)

также обеспечивали исходный кодирующий смысл следующей за

ними
нуклеотидной последовательности. Отсюда
следует,
что код

является триплетным, и триплеты считываются последовательно,

без
«запятых»,
со строго фиксированной точки, в одной и той же

фазе.
Эти же опыты указывали, что код вырожден: если бы большая

часть из 64 возможных триплетов была бессмысленной, то существо-

вала бы высокая вероятность появления
хоть
одного бессмысленного

триплета в участке
между
вставкой и делецией или
между
тремя

вставками, где чтение происходит со сдвигом рамки (в
другой
фазе),

что прерывало бы непрерывность полипептидной цепи белка-про-

дукта.

Расшифровка
смысла нуклеотидных триплетов началась также в

1961 г., когда М. Ниренберг и Г. Маттей открыли кодирующие свой-

ства синтетических полирибонуклеотидов при их использовании

вместо природных
мРНК
в бесклеточных системах трансляции.

Возможность получения синтетических полирибонуклеотидов различ-

ного состава с помощью специального фермента, полинуклеотид-

фосфорилазы,
была впервые продемонстрирована М. Грюнберг-

Манаго в лаборатории С. Очоа за несколько лет до этого. Состав

синтезированного полинуклеотида в описанной ими реакции зависел

только от набора рибонуклеозиддифосфатов в качестве субстратов;

простейшими
синтезированными полирибонуклеотидами были гомо-

полинуклеотиды, такие как полиуридиловая кислота, полиадениловая

кислота и полицитидиловая кислота, получаемые из УДФ, АДФ или

ЦДФ,
соответственно. Используя поли (U) в качестве матричного

полинуклеотида для рибосомы
Е.
coli,
M. Ниренберг и Г. Маттей пока-

зали,
что синтезирующимся полипептидным продуктом является по-

лифенилаланин.
Отсюда вытекало, что триплет
UUU
кодирует фенил-

аланин.
Таким же образом в опытах с полиадениловой и с поли-

цитидиловой кислэтами было показано, что ААА кодирует лизин,

а
ССС
— пролин.

Дальнейшая расшифровка кода была основана на использовании

синтетических статистических гетерополинуклеотидов определенно-

го состава, задаваемого набором и соотношением субстратных нуклео-

зиддифосфатов в полинуклеотидфосфорилазной реакции. Так, было

показано,
что статистический сополимер поли(и, С) кодирует вклю-

чение в полипептидную цепь четырех аминокислот: фенилаланина,

лейцина,
серина и пролина. Если соотношение U :
С
в полинуклеотиде

было 1:1, то все четыре аминокислоты включались в полипептид

14

с равной вероятностью. Если соотношение U : С было 5 : 1, то вероят-

ности
включения аминокислот располагались в последовательности

Phe>Leu
=
Ser>Pro. Следовательно, фенилаланин должен кодиро-

ваться триплетами, состоящими из
трех
U и из
двух
U и одного С;

лейцин
и серии —триплетами, состоящими из
двух
U и одного С и из

двух
С и одного U; пролин — триплетами из
трех
С и из
двух
С и одно-

го U. К сожалению, этот
метод
мог
дать
только состав кодирующих

триплетов, но не их нуклеотидную последовательность, так как нук-

леотидная последовательность используемых матричных полинукле-

отидов была статистической.

Тем не менее, нуклеотидные последовательности кодирующих

триплетов были вскоре расшифрованы благодаря изобретению

М. Ниренбергом и
Ф.
Ледером новой техники их тестирования. Оказа-

лось, что кодирующими свойствами
обладает
индивидуальный

тринуклеотид:
будучи
ассоциирован с рибосомой, он приводит к

избирательному связыванию рибосомой определенной аминоацил-

тРНК
из среды. Так, например, триплеты UUU и UUC давали в

результате
связывание с рибосомой фенилаланил-тРНК, трипле-

ты UCU и UCC индуцировали связывание серил-тРНК, трипле-

ты CUU и
CUC

лейцил-тРНК
и триплеты CCU и
ССС
—пролил-

тРНК.
К 1964 г. методы ферментативного и химического синтеза

тринуклеотидов заданной последовательности уже существовали,

и
тестирование широкого набора тринуклеотидов в течение последую-

щих
двух
лет привело -к расшифровке практически всего кода

(см.
рис. 3).

Финалом
этой истории было использование синтетических поли-

нуклеотидов с регулярной нуклеотидной последовательностью в ка-

честве
матриц в бесклеточных системах синтеза полипептидов на

рибосомах. Методы синтеза регулярных полинуклеотидов были раз-

работаны Г. Хорана, и им же генетический код был прямо проверен

путем
использования их как матриц. В полном соответствии с кодом,

использование поли(иС)я в качестве матрицы
дало
полипептид,

построенный
из
чередующихся
серина и лейцина, а поли(иО),, при-

водил к синтезу регулярного полипептидного сополимера с чере-

дующимися валином и цистеином. Поли
(AAG)»
кодировал синтез

трех
гомополимеров:
полилизина,
полиаргинина
и
полиглютаминовой

кислоты.

3.
НЕКОТОРЫЕ
ОСОБЕННОСТИ
КОДОВОГО
СЛОВАРЯ

На
рис. 3 дан полный кодовый словарь. Из 64 триплетов, получивших

название
кодонов,
61 являются «значащими», (смысловыми) в том

смысле, что кодируют аминокислоты. Только 3 кодона —
UAG
(«ян-

тарь»),
UAA
(«охра»)
и UGA
(«опал»)

не
кодируют никакой амино-

кислоты и потому иногда называются «бессмысленными». Роль
«бес-

смысленных» триплетов в трансляции очень важн*а, так как в
мРНК

они
служат
сигналом терминации синтеза полипептидной цепи белка;

в
настоящее время их обычно называют
терминатор
ными
кодонами.

Вырожденность кода распространяется не на все аминокислоты.

15

Вторая
буква

о

m

ас

чэ

(X

О)
и

с

А

G
и

UUUIphp

uuclPhe

U U
Al
Leu

UUGJLeu

сии

CUC

CUA

CUG

AUU

AUC

AUA

AUG

GUU

GUC

GUA

GUG
Leu

lle

Met

Val
С
cccc
oooo
o>oc

Ser

CCU1

CCClpro

CCA|

CCGJ

ACU

ACC

АСА

ACG.

GCU

GCC

GCA

GCG
Thr

Ala
А

UAA
Ochre

UAGAmbei

!}";:

AAUlAsn

AACjASn

AAAlLvs

AAGJLys

GAUl

GAC

GAA

GAG.
Asp

Glu
G

ЯСу*

UGAOpal

UGG
Trp

oooo
oo
о о
,o>oc

AGU

AGC

AGA

AGG.

GGU

GGC

GGA

GGG
Arg

Ser

Arg

Gly
U

С

А

G

и

С

А

G

и

С

А

G

и

С

А

G
2

|

а>

.а.

Рис.
3.
Кодовый словарь

Так,
две аминокислоты —
метионин
и
триптофан — кодируются всего

одним кодоном каждая (AUG и
UGG,
соответственно). С
другой
сто-

роны,
три
аминокислоты —
лейцин,
серии
и
аргинин — имеют шесть

кодонов
каждая. Остальные аминокислоты,
за
исключением
изо-

лейЦина,
кодируются либо двумя, либо четырьмя кодонами; только

изолейцину
соответствуют три кодона.

Следует
обратить особое внимание
на
то,
что
триплеты, коди-

рующие одну
и ту же
аминокислоту,
в
большинстве случаев
раз-

личаются только по третьему нуклеотидному остатку. Лишь в тех слу-

чаях, когда аминокислота имеет более четырех кодонов, различия
в

кодонах затрагивают также первое
и
второе положения
в
триплете.

Если
вся группа четырех кодонов, различающихся только по третьему

нуклеотиду, кодирует одну и
ту
же аминокислоту, то можно говорить

о
семье
кодонов.
Как видно
из
рис.
3,
имеется восемь таких семей

кодонов
— для лейцина, валина, серина, пролина, треонина, аланина,

аргинина
и
глицина.

Код,
данный на рис. 3, является универсальным для белоксинтези-

рующих систем бактерий
и
цитоплазмы
всех
эукариот, включая

животных, грибы
и
высшие растения. Однако
в
живой природе

имеются также
и
исключения. По крайней мере белоксинтезирующие

системы митохондрий животных (млекопитающих)
и
грибов обнару-

живают ряд отклонений
от
этого универсального кода. Так,
в
мито-

хондриях изученных эукариотических организмов триптофан коди-

руется
как
UGG,
так и
UGA; соответственно,
UGA
не
является

терминирующим кодоном.
В
митохондриях млекопитающих (чело-

века) кодоны AGA и AGG — терминирующие
и
не кодируют аргинин.

В митохондриях дрожжей
вся
кодоновая семья CUU, CUC, CUA
и

CUG
кодирует треонин,
а
не
лейцин (хотя
в
митохондриях
другого

гриба,
Neurospora,
они кодируют лейцин,
в
соответствии
с
универ-

сальным кодом).

16

4.
СТРУКТУРА
мРНК

Первичная
структура

В отличие от ДНК,
мРНК
(как и
другие
виды клеточной РНК) пред-

ставляет собой однотяжевой полинуклеотид. Он состоит из линейно

расположенных четырех сортов рибонуклеозидных остатков — аде-

нозина
(А), гуанозина (G), цитидина (С) и уридина (U), последо-

вательно соединенных фосфодиэфирными связями
между
З'-гидрок-

силом рибозы одного нуклеозида и 5'-гидроксилом соседнего нуклео-

зида (рис. 4). Концевой нуклеозид, где 5'-гидроксил не
участвует
в

образовании межнуклеотидной связи, обозначается как 5'-конец РНК,

а
другой
концевой нуклеозид со свободным З'-гидроксилом назы-

вают З'-концом РНК. Принято писать и читать последовательность

нуклеотидных остатков в РНК от 5'-конца к З'-концу, т. е. в направле-

нии
межнуклеотидной фосфодиэфирной связи от З'-гидроксила

к
5'-гидроксилу соседа (направление связи 3'—Р—5').
Следует
отме-

тить, что именно в этом направлении
мРНК
читается рибосомой.

В природных
мРНК
5'-концевой гидроксиЛ всегда, замещен.

У прокариотических организмов он просто фосфорилирован либо

моно-,
либо трифосфатом (рис. 4). Эукариотические
мРНК
в большин-

стве случаев несут на концевом 5'-гидроксиле специальную допол-

нительную группу —так называемый «кэп», представляющий собой

модифицированный
(^-метилированный) остаток гуанозин-5'-три-

фосфата, соединенный с концевым нуклеозидом необычным
5'—5'-

способом (рис. 5). В эукариотах
существует
специальная ферментная

система, включающая гуанилилгрансферазу и метилтрансферазы,

которые осуществляют это «кэппирование»
мРНК;
«кэппирование»

сопровождается также метилированием 2'-гидроксила рибозы и,

часто, основания 5'-концевого (примыкающего к
«кэпу»)
нуклеозида

(рис.
5).
Следует
отметить, что 5'-концевыми нуклеозидами в
мРНК

чаще всего являются пуриновые нуклеозиды (G или А).

З'-концевой
гидроксил природных
мРНК
свободен. Таким образом,

на
З'-конце имеется два гидроксила в цисположении (i/ис-гликольная

группировка) (рис. 4).

Функциональные
участки

Физическая
длина цепи
мРНК,
по-видимому, никогда не равна длине

ее кодирующей последовательности. Кодирующая последователь-

ность составляет лишь часть общей длины полинуклеотиднои цепи

мРНК.
Во-первых, первому кодону всегда предшествует более или

менее протяженная некодирующая 5'-концевая последовательность.

Во-вторых, терминирующий кодон никогда не заканчивает цепь

мРНК,
а за ним всегда
следует
некодирующая З'-концевая последо-

вательность. В дополнение к этому, эукариотические
мРНК
часто

(но
не всегда) продолжаются в длинную декодирующую З'-концевую

полиадениловую последовательность, которая добавляется к
мРНК

специальным ферментом (полиаденилатполимеразои) после заверше-

ния
транскрипции.

17

NH,
Очень важным является

вопрос,
что определяет нача-

ло кодирующей части нуклео-

тидной последовательности в

пределах цепи
мРНК.
Извест-

но,
что любая полипептид-

ная
цепь начинает синтези-

роваться с N-концевого

метионинового остатка и,

следовательно, первый кодон

на
мРНК
должен кодировать

метионин.
Оказалось, что в

большинстве случаев такими

инициаторными
кодонами
яв-

ляются AUG, и гораздо реже

GUG
или UUG. Кодон AUG

кодирует метионин в любых

случаях —
и
когда он является

первым кодоном кодирующей

последовательности
мРНК,
и

когда он является внутренним

кодоном.
Однако кодон GUG

внутри кодирующей после-

довательности кодирует ва-

лин,
и только
будучи
первым

в
кодирующей последова-

тельности кодирует инициа-

торный
метионин. Инициа-

торными
кодонами, кодирую-

щими
инициаторный метио-

нин,
могут
быть также UUG,

AUA, AUU и, возможно,

CUG.

Однако идентификация

ряда кодонов как инициатор-

ных не решает проблему на-

чала кодирующей части, а ста-

вит ее. Действительно, от-

нюдь не любой триплет AUG

и
GUG может стать инициа-

торным.
Внутренние кодо-

ны
AUG и
GUG,
как правило,

не
могут
инициировать транс-

ляцию.
При сканировании

цепи
мРНК,
начиная с ее 5'-конца, триплеты AUG и GUG
могут

неоднократно
попадаться как в фазе с последующей кодирующей

последовательностью, так и не в фазе, и тем не менее они не

инициируют трансляцию. Наконец, многочисленные триплеты AUG

и
GUG
в пределах кодирующей последовательности, но находящиеся

18
и

он
он

Рис. 4.
Нуклеотидные
остатки
РНК'

/
Н-/ Y N
кэп

он
он

Рис.
5. «Кэп» на 5'-конце эукариотической
мРНК

не
в
фазе, тоже
не
инициируют синтеза бессмысленных полипепти-

дов. Следовательно, инициаторный кодон,
в
отличие
от
всех
других

кодонов,
как
кодирующих аминокислоты,
так и
терминаторных

(см.
рис. 3),
определяется
не
только
его
собственной структурой

(его составом
и
последовательностью),
но
также
и его
положением

в
структуре
мРНК.
Пока окончательно
не
ясно,
какие элементы

структуры
делают
триплет
AUG или
GUG инициаторным кодоном.

Ряд
данных указывает
на
существенную роль нуклеотидной после-

19

довательности, предшествующей инициаторному кодону (см. гл.
B.VI).

Возможно, что определенная вторичная и третичная
структура
дан-

ного района
мРНК
необходима, чтобы особым образом экспониро-

вать соответствующий триплет как инициаторный кодон (см. ниже).

Одна полинуклеотидная цепь
мРНК
не обязательно содержит

только одну кодирующую последовательность. Для прокариотических

мРНК
очень обычно, что одна полинуклеотидная цепь включает

кодирующие последовательности для нескольких белков. Такие

мРНК
получили название
полицистронных
мРНК (происходит от

термина «цистрон», введенного С. Бензером как эквивалент гена).

Различные
кодирующие последовательности
(цистроны)
в пределах

одной
цепи
мРНК
обычно разделены некодирующими последова-

тельностями. Такая внутренняя некодирующая последовательность

начинается
после терминаторного кодона предшествующего цистро-

на;
иногда в ее начале имеется еще один терминаторный кодон,

по-видимому, дублирующий терминаторный кодон цистрона на

случай почему-либо не состоявшейся терминации. Следующий цист-

рон
снова начинается с инициаторного кодона AUG или GUG.

Хорошим примером полицистронной
мРНК
является РНК малого

РНК-содержащего бактериального вируса (фага) MS2. Фаг MS2 —

сферический;
он имеет диаметр 2,5 нм и молекулярную мас-

су 3,6 • 106 дальтон. Фаг построен из 180 субъединиц белка оболочки

с молекулярной массой
14700
дальтон каждая, одной молекулы так

называемого А-белка с молекулярной массой
38000
дальтон и одной

молекулы РНК с молекулярной массой 106 дальтон. После попадания

фага в клетку Е.
coli
(а также в бесклеточной системе трансляции)

эта
РНК
служит матрицей для белка оболочки, А-белка и субъединицы

РНК-репликазы
с молекулярной массой
62000
дальтон, которая в состав

фага не
входит.
Схема расположения соответствующих цистронов

вдоль цепи этой
мРНК
дана на
рис.
6. Цепь начинается с G, имеющего

трифосфат на своем 5'-гидроксиле. Далее
следует
длинная некодирую-

щая
нуклеотидная последовательность. Общая длина 5'-концевой

некодирующей последовательности 129 остатков; в ней встречаются

триплеты AUG и
GUG,
которые, однако, не являются
инициаторными.

Первый
инициаторный кодон, GUG, начинает кодирующую после-

довательность А-белка (А-цистрон). А-цистрон имеет длину 1179 ос-

татков и заканчивается терминаторным кодоном UAG. Затем идет

некодирующая вставка длиной 26 остатков. Следующая кодирующая

последовательность начинается с AUG и имеет длину 390 остатков;

это
—цистрон белка оболочки (С-цистрон). Он оканчивается терми-

наторным
кодоном UAA, и за ним непосредственно
следует
второй

терминаторный кодон UAG. Последовательность длиной 36 остатков

отделяет
С-цистрон
от S-цистрона, кодирующего субъединицу
РНК-синте-

тазы. S-цистрон начинается с AUG, имеет длину 1635 остатков и

заканчивается UAG. За ним через один остаток (т. е. не в фазе)

имеется еще один терминаторный триплет UGA. 3'-концевая некоди-

рующая последовательность имеет общую длину 174 остатка и

заканчивается аденозином со свободной г/ис-гликольной группиров-

20

PPP866....GUG
А

1182

UAGAUG

13П
1335

з1

.ACC...AGUCSAU
UAA AUG

MS2
РНК

Рис.
6.
Схема расположения кодирующих
и
декодирующих нуклеотидных

последовательностей вдоль цепи РНК фага MS2:

А, С, L и S

цистроны, кодирующие белки «созревания», оболочки, лизиса и репли-

казы («синтетазы»), соответственно. Крупные цифры указывают количество нукле-

отидных остатков в данном отрезке, мелкие

положения нуклеотидных остатков.

кой.
Полная первичная
структура
РНК
фага
MS2
была определена

В. Фирсом
с
сотр.
в
1971—1976
гг.

В связи
с
рассмотрением РНК фага MS2,
следует
указать также

на
другой
способ размещения разных кодирующих последователь-

ностей
в
одной
мРНК.
Дело
в том, что MS2
РНК кодирует
еще и

четвертый белок, названный белком лизиса,
или
L-белком
(он, по-

видимому,
участвует
в
лизисе хозяйской клетки
на
завершающей

фазе
инфекции).
Этот белок закодирован участком РНК, начинаю-

щимся
в
конце С-цистрона, захватывающим
всю
36-нуклеотидную

вставку
между
С-цистроном
и
S-цистроном
и
заканчивающимся
в

пределах S-цистрона; рамка считывания этого перекрывающегося

L-цистрона сдвинута вправо
на
один остаток (+1 сдвиг),
так что
ни-

какие
его
участки
не
транслируются
при
синтезе С-белка
и
S-белка.

L-цистрон имеет свой инициаторный кодон AUG,
не в
фазе
с
кодо-

нами
С-цистрона, и, соответственно, свой терминаторный кодон
UAA,

не
в
фазе
с
кодонами S-цистрона.
Эта
ситуация изображена
на
рис.
7.

Использование
перекрывающихся кодирующих последовательностей

в
пределах одной
мРНК
встречается, однако,
не
часто
и
свойственно,

по-видимому,
в
основном вирусным системам,
где
экономия места

для размещения цистронов играет особенно важную роль.

В отличие
от
прокариотических
мРНК,
мРНК
эукариот,
как пра-

вило,
моноцистронны,
т. е.
кодируют всего одну полипептидную

цепь.
Кодирующая последовательность
мРНК
также фланкирована,

как
с
5'-конца,
так и с
З'-конца, некодирующими последовательно-

стями.
Уже
отмечалось,
что
5'-конец обычно модифицирован «кэпом»

(см.
рис. 5),
имеющим, по-видимому, значение
для
первичной

(преинициаторной)
ассоциации
мРНК
с
рибосомой. Здесь
следует

указать
на
возможную разницу
в
механизме поиска инициирующего

21

MET
GLU THR
ARG PHE
PRO GLN
GLN SER GLN GLN THR PRO ALA SER

CAAGGUCUCCUAAAAG
A UG
GAAACCCGAUUCCCUCAGCAAUCGCAGCAAA (Ml,С
С
G
G С A U С

GLN
6LY LEU LEU LYS
A~ST~GLY
ASN PRO ILE PRO SER ALA ILE ALA ALA ASN SER GLY ILE

1678

THR
ASN ARG ARG ARG PRO PHE LYS HIS GLU ASP TYR PRO CYS ARG ARG GLN GLN ARG SER

UACUAAUAGACGCCGGCCAUUCAAACAUGAGGAUUACCCAUGUCGAAGACAACAAAGAAG

TYR
MET SER LYS THR THR LYS LYS

SER
THR LEU TYR VAL LEU ILE PHE LEU ALA ILE PHE LEU SER LYS PHE THR ASN GLN LEU

UUCAACUCUUUAUGUAUUGAUCUUCCUCGCGAUCUUUCUCUCGAAAUUUACCAAUCAAUU

PHE
ASN SER LEU CYS ILE ASP LEU PRO ARG ASP LEU SER LEU GLU ILE TYR GLN SER ILE

LEU
LEU SER LEU LEU GLU ALA VAL ILE ARG THR VAL THR THR LEU GLN GLN LEU LEU THR

GCUUCUGUCGCUACUGGAAGCGGUGAUCCGCACAGUGACGACUUUACAGCÄAUUGCUUACU
UА А

ALA
SER VAL ALA THR GLY SER GLY ASP PRO HIS SER ASP ASP PHE THR ALA ILE ALA TYR
(CETJ~

1902

Рис.
7. Нуклеотидная последовательность, кодирующая L-белок фага MS2, начиная с нуклеотидного остатка 1678:

Аминокислотная
последовательность L-белка указана
вал, а
последовательности конца С-белка
и
начала
S-белка
под
муклеотидной

последовательностью (по М. N. Beremand, Т. Blumenthal, Cell, 1979,
v.
18, р.
257-266)

кодона в прокариотической и эукариотической системах трансляции:

прокариотические рибосомы ассоциируют с
мРНК
и
узнают
иниции-

рующий кодон независимо.от 5'-конца, и поэтому широко используют

«внутреннюю»
инициацию
в полицистронных
мРНК;
в противоположность

этому,
эукариотические
рибосомы
обычно
нуждаются
в
5
'-конце
мРНК
для

ассоциации
с ней, и «кэп», вероятно, способствует такой ассоциации (см.

гл.
B.VII).
Считается, что в большинстве
случаев
в эукариотических

системах
первый
AUG
кодон
от 5'-концаявляется
инициаторным.
З'-конец

эукариотических
мРНК
часто неопределенен: длина З'-концевой
неко-

дирующей последовательности может варьировать у разных молекул

одной
и той же
мРНК.
Кроме того, как уже отмечалось, подавляющая

часть эукариотических
мРНК
несет на З'-конце полиадениловые после-

довательности варьирующей длины.

Пространственная
структура

Что касается пространственной (трехмерной)
структуры
мРНК,
то, к со-

жалению, в настоящее время она не установлена ни в одном
случае.

Из
измерений различных физических параметров некоторых
мРНК
ясно,

что они представляют собой сильно свернутые
структуры,
с большим

количеством внутрицепных взаимодействий
между
азотистыми основа-

ниями
типа Уотсон-Криковского комплементарного спаривания.
Хотя

мРНК
не являются двойными спиралями типа
ДНК,
они обнаруживают

развитую
вторичную
структуру
за
счет
комплементарного спаривания

отдельных участков одной и той же цепи
друг
с
другом,
с образованием

большого набора относительно коротких двуспиральных участков. Около

70%
всех
нуклеотидных остатков в цепи
участвует
в комплементарном

спаривании
и,
соответственно,
в
формировании
внутримолекулярных
спи-

ралей. Большая часть двуспиральных участков образуется, по-видимому,

за
счет
комплементарного
спаривания
смежных отрезков полинуклеотид-

ной
цепи;
схема
формирования
таких коротких двойных спиралей дана на

рис.
8. Комплементарное спаривание далеко отстоящих отрезков цепи

должно приводить
к
дополнительному сильному складыванию
структуры

и
формированию компактных доменов в
мРНК,
как показано на рис. 9.

В основе этих взаимодействий, формирующих вторичную
структуру
мРНК,

лежат
спаривания А с U и G с С (Уотсон-Криковские пары), а также, по-

видимому, G с
U
(см. рис. 19).
О
взаимодействиях, формирующих третич-

ную
структуру,
и о самом характере третичной
структуры
мРНК
ничего не

известно.

В то же время имеется целый ряд указаний на роль вторичной и тре-

тичной
структуры
мРНК
в трансляции. Уже отмечалось, что пространст-

венная
структура
инициаторного
участка
мРНК
может быть важной или

даже
решающей, чтобы триплет
AUG
(или
GUG)
мог играть роль
инициа-

торного
кодона.
По-видимому,
необходимо, чтобы собственно
инициатор-

ный
триплет либо вовсе не был вовлечен в Уотсон-Криковское спарива-

ние
с
другими нуклеотидами
мРНК,
либо
участвовал
в
слабом (нестабиль-

ном)
комплементарном спаривании. Другими словами, инициаторный

кодон
должен быть либо уже открыт, либо легко открываться для взаимо-

действия с
инициаторной
тРНК
на рибосоме.
Из
предсказания вторичной

23

Рис.
8.
Схема
формирования вторичной

структуры (двуспиральных шпилек) пу-

тем
спаривания смежных отрезков

полинуклеотидной
цепи РНК
структуры
на
основании взаимной

комплементарное™ смежных
участ-

ков
цепи
следует,
что
неспаренный

AUG
триплет действительно имеется

в
начале цистрона белка оболочки

фага MS2
РНК
(рис.
10); этот триплет

расположен как раз на
верхушке
дву-

спиральной
шпильки,
образуя петлю.

Именно
он,
как
изестно,
является
пре-

имущественным местом инициации

синтеза белка на MS2
РНК.
Интерес-

но,
что
инициация на инициаторных

кодонах
других
цистронов MS2 РНК

идет
значительно менее
эффективно.

Это
согласуется
с тем, что например,

инициаторный
триплет AUG цистро-

на
субъединицы
РНК-синтетазы
вхо-

дит в состав двуспирального
участка,

который,
по-видимому, не очень ста-

билен,
так как
короток
и
дефектен,

но
тем не менее тормозит его прояв-

ление
в
инициации. Существование

вторичной
структуры
в
районе,
захва-

тывающем терминаторный кодон цистрона белка оболочки и инициатор-

ный
кодон цистрона синтетазы, было прямо показано
в
экспериментах

Дж. Стейтс
и
Д. Кротерса
с
соответствующим фрагментом РНК
род-

ственного бактериофага R17
(рис.
11).

По-видимому, стабилизация двуспирального
участка
с
участием
ини-

циаторного
триплета
либо
за
счет
третичной
структуры
РНК,
либо
в
резуль-

тате
специфического присоединения РНК-связывающего белка, может

полностью блокировать инициацию в данном участке.
Так,
очень похоже,

что в MS2
РНК,
а также в
РНК
родственных фагов
R17,12
и
др.
третичной

структурой
заблокированы инициаторные триплеты как А-цистрона, так

и
S-цистрона.
Инициация
на
А-цистроне происходит, вероятно, лишь
в

процессе синтеза
РНК,
когда полная пространственная
структура
еще
не

сформирована.
Инициация
на S-цистроне имеет место
в
процессе трансля-

ции
предшествующего С-цистрона: рибосомы, считывая С-цистрон, рас-

плетают
РНК,
освобождая участок
с
инициаторным
триплетом S-цистрона

из
какого-то более стабильно свернутого состояния. Когда появляются

готовые молекулы белка оболочки фага, снова происходит выключение

инициации
S-цистрона: белок оболочки фага имеет специфическое срод-

ство к нестабильной спирали, содержащей инициаторный AUG триплет

(рис.
11),
и,
связываясь
с
ним,
стабилизирует спираль.

После
того
как инициация трансляции состоялась, рибосомы
могут

читать
мРНК
более или менее независимо
от ее
вторичной
и
третичной

структуры,
очевидно,
последовательно расплетая ее
по
мере прохождения

вдоль
цепи
(разумеется, после прохождения рибосомы участки
цепи
вновь

свертываются). В
то
же время пока ничего не известно
о
роли вторичной

и
третичной
структуры
мРНК
в
скорости считывания
цепи
(скорости
элон-

24

с.6

AA:,V

и

с-

G

GUUА CUCUUU

AGÄGÄAÄ

С
"

с
с

Аон
ч

G-C

и-д
G

А

А

„U

А.
-G

5'
===='

Рис.
9. Схема вероятной вторичной структуры 3'-концевого

домена
РНК вируса мозаики костра:

а

нуклеотидная последовательность
и
комплементарность спаренных

участков цепи
(по R.
Dasgupta,
P.
Kaesberg.
Proc. Nat.
Acad.
Sei
USA. 1977,

v. 74,
р.
4900-4904;
M.
R.
Gunn
et at.
FEBS
Leu.,
1980,
v. 155, p.
77-82);

6

та
же
структур*
в
виде двуспиральных участков, соединенных

однотяжевыми отрезками

G

G •
С

А •
U

А

U

G

С

U
U

U

А

U

А

G

С

А

U

G

U

l
G

U ,

5...-С ААСС ACUC A....3

Рис.
10. Схема вероятной вторичной структуры

(двуспиральной
шпильки)
участка РНК фага

MS2,
содержащего инициаторный кодон AUG

цистрона белка оболочки фага (по J. А.
Steitz,

Nature,
1969,
v. 224, р.
957-964)

U

А

С-
G

U

А

А

U

U
G

G
С

G • С А

U|
ИНИЦИАТОР

С
G

5*
С А А А С U
CCAUUCAA
CG з'

Рис.
11. Схема вторичной структуры фрагмента РНК фага R17, охва-

тывающего конец цистрона белка оболочки и начало цистрона

синтетазы (по J. Gralla et al. Nature,
1974,
v.
248,
р.
204-208).

гации
полипептида).
Известно,
что эта
скорость
неравномерна,
и не
исклю-

чено,
что она
зависит
от
стабильности
вторичной
и
третичной
структуры

участков
мРНК
(см. гл.
B.V).

26

Следует
обратить
особое
внимание
на
некодирующие
последователь-

ности
в
мРНК.
Их
значение,
в
частности,
может состоять в детерми-

нации
специальных
пространственных
(вторичных
и
третичных)
структур,

регулирующих
инициацию
трансляции,
элонгацию
и
переход
рибосом
от

одного
цистрона
к
другому,
а
также
присоединение
к
мРНК
специальных

узнающих
белков,
воздействующих
на
трансляцию.

Рекомендуемая литература

Биологическое воспроизведение
макромолекул:
Пер. с англ./Под ред. В. Л. Рыж-

кова. М.: ИЛ, 1960. С.
209-246.

Биосинтез белка и его
регуляция:
Пер. с англ./Под ред. Я. М. Варшавского. М.:

Мир,
1967. С.
105-125;
237-258.

Живая
клетка: Пер. с англ./Под ред. Г. М. Франка. М.: ИЛ, 1962. С.
203-221.

Молекулы
и клетки: Пер, с англ./Под ред. Г. М. Франка. М.: Мир, 1968. С.
48—60.

Нуклеиновые кислоты: Пер. с англ./Под ред. А. Н. Белозерского. М.: Мир, 1965.

С.
153-244.

Регуляторные механизмы клетки: Пер. с англ./Под ред. И. Б. Збарского. М.:

Мир,
1964. С
111-133;
150-163;
164-195;
278-306;
477-497.

Структура и
функция
клетки: Пер. с англ./Под ред. Г. М. Франка. М.: Мир,

1964.
С. 9-55.

Ичас
М.
Биологический код: Пер. с
англ.
яз. М.: Мир, 1971.

Спирин
А. С, Белозерский А. И.,
Шугаева
Н. В., Ванюшин В. Ф. Изучение видовой

специфичности
нуклеиновых
кислот у бактерий.

Биохимия, 1957. Т. 22, Ns 4. С.
744—754.

The Genetic Code. - Cold Spring Harbor Symp. Quant Biol.,
1966,
v. 31.

The
Mechanism
of Protein Synthesis. - Cold Spring Harbor Symp. Quant Biol.,
1969,
v. 34.

Bosch L., ed. The Mechanism of Protein Synthesis and Its Regulation.
Amsterdam,

London: North-Holland,
1972,
p.
395-464; 487-514.

Cohn
W. £., Volkin E., eds. mRNA: The Relation of Structure to Punction. Progress

in
Nucleic Acid Research and Molecular Biology. N. Y.: Acad. Press, 1976, v. 19.

Davidson
J. N., Cohn W. E., eds. Progress in Nucleic Acid Research and Molecular

Biology.
N. Y.: Acad. Press, 1967, v. 7, p. 107-172.

Slonimski
Р., Borst Р.. Attardl G., eds. Mitochondrial Genes. N. Y.: Cold Spring Harbor

Laboratory, 1982.

Weissbach #., Pestka S., eds. Molecular Mechanisms of Protein Biosynthesis. N. Y.:

Acad. Press, 1977, p.
555-601.

Woese С R. The Genetic Code: the Molecular Basis for Genetic Expression. N. Y.:

Harper & Row, 1967.

Aveiy О. Т., MacLeod С M., McCarty M. Studies in the Chemical nature of the

substance
inducing
transformation of pneumococcal types. - J. Exptl. Med., 1944, v. 78,

p.
137-158.

Belozersky A. N.. Spinn A. S. A correlation between the compositioos of deoxyribonucleic

and ribonucleic acids. - Nature,
1958,
v.
182,
p.
111-112.

Brenner S., Jacob F., Meselson M. An unstable intermediate carrying Information
from

genes to ribosomes for protein synthesis. - Nature, 1961, v. 190, p.
576-581.

Crick
F. H. С The present Position of the coding
problem.
- Brookhaven Symp. Biol.,

1959,
v. 12, p.
35-38.

Crick
F. H. С The origin of the genetic code. - J. Mol. Biol., 1968, v. 38, p.
367-379.

Crick
F. H. С Bamett L., Brenner S., Watts-Tobin R. J. General nature of the

genetic code for proteins. - Nature, 1961, v. 192, p.
1227-1232.

Doty
Р., Boedtker H., Fresco J. R. et al. Secondary structure in ribonucleic acids. -

Proc.
Nat Acad. Sei. U.S.A., 1959, v. 45, p.
482-499.

Fiers W., Contreras
R-,
Duerinck F. et al. Complete nucleotide sequence of bacteriophage

MS2
RNA: Primary and secondary structure of the replicase gene. - Nature, 1976, v. 260,

p.
500-507.

Gamov G., Rieh A., Ycas M. The
problem
of Information transfer
from
the nucleic

acids to proteins. -
Advan.
Biol. Med. Phys., 1956, v. 4, p.
23-68.

Gros F., Hiatt #., Gilbert W. et al. Unstable ribonucleic acid reveaied by pulse

labeling of
•Escherichia
coli. - Nature, 1961, v. 190, p.
581-585.

27

Grunberg-Manago
M., Ochoa S. Enzymatic synthesis and breakdown of polynucleotides:

Polynucleotide phosphorylase. - J. Amer. Chem. Soc, 1955, v. 77, p. 3165-3166.

Hershey A. D., Chase M. Independent functions of viral protein and nucleic acid in

growth of bacteriophage. - J. Gen. Physiol., 1952, v. 36, p. 39-56.

Jacob F., Monod J. Genetic regulatory mechanism in the synthesis of protein. - J. Mol.

Biol., 1961, v. 3, p. 318-356.

Nirenberg M. W., Matthaei J. H. The dependence of cell-free protein synthesis in

E.
coli upon naturally occurring or synthetic polyribonucleotides. - Proc. Nat. Acad. Sei.

U.S.A., 1961, v. 47, p. 1588-1602.

Orgel L. E. Evolution of the genetic apparatus. - J. Mol. Biol., 1968, v. 38, p. 381-393.

Shatkin A. J. Capping of eucaryotic mRNAs. - Cell, 1976, v. 9, p. 645-653.

Volkin £., Astrachan L. Phosphorus incorporation in
Escherichia
coli ribonucleic acid

after infection with bacteriophage T2. - Virology, 1956, v. 2, p. 149-161.

Watson J. D., Crick
F.H.C.
Molecular strueture of nucleic aeids. - Nature, 1953, v. 171,

p.
738-740.

Watson J. D., Crick F.H.C. Genetical implications of the strueture of deoxyribose

nucleic acid. - Nature, 1953, v. 171, p. 964-967.

Глава III

ТРАНСПОРТНЫЕ РНК

И
АМИНОАЦИЛ-тРНК-СИНТЕТАЗЫ

1. ОТКРЫТИЕ

Итак,
информация для аминокислотной последовательности белков

закодирована в виде нуклеотидной последовательности
соответствую-

щих матричных РНК. Триплетный кодон матрицы должен однозначно

детерминировать определенную аминокислоту.
Между
тем, явного

стерического соответствия
структур
аминокислот и
соответствующих

им
кодонов не наблюдается, т. е. кодоны
вроде
бы никак не
могут

служить
прямыми матричными поверхностями для аминокислот.
Отсюда

в 1955 г. Ф.
Крик
предложил свою
«адапторную
гипотезу»,
где он

постулировал существование специальных малых адапторных РНК и

специальных ферментов, ковалентно присоединяющих аминокислотные

остатки к этим
РНК.
Согласно гипотезе, каждой аминокислоте соответ-

ствует
свой вид адапторной РНК и свой фермент, присоединяющий

только данную аминокислоту к данному
адаптеру.
С
другой
стороны,

адапторная
РНК
имеет нуклеотидный триплет (впоследствии названный

антикодоном), комплементарный
соответствующему
кодону матричной

РНК
Таким образом, узнавание кодона аминокислотой не является

непосредственным, а осуществляется через систему адапторная
РНК


фермент: специфический фермент
узнает
одновременно аминокислоту

и
определенную адапторную
молекулу,
так что они оказываются соеди-

ненными;
в свою очередь, адаптор (с навешенной аминокислотой)

узнает
определенный кодон матричной РНК, так что присоединенная

аминокислота становится приписанной именно данному кодону.

В дополнение к решению проблемы узнавания, предложенный механизм

предполагал также энергетическое обеспечение полимеризации амино-

кислот за
счет
химических связей, образованных
между
аминокислот-

ными
остатками и адапторными молекулами.

28

Поразительно, что все это вскоре было подтверждено эксперимен-

тально. В 1957 г. М. Хогланд, П. Замечник и М. Стефенсон в США и

К.
Огата
и X. Нохара в Японии сообщили об открытии относительно

низкомолекулярной РНК («растворимой РНК») и специальной фермент-

ной
фракции («pH 5 фермент»), присоединяющей аминокислоты к этой

РНК.
Было показано, что образующаяся аминоацил-тРНК действительно

является промежуточным соединением в переносе аминокислоты в поли-

пептидную цепь белка. Впоследствии эта РНК была названа транс-

ферной,
а в русском переводе «транспортной» РНК, или тРНК, а со-

ответствующие
ферменты

аминоацил-тРНК-синтетазами.

В клетке для каждой из 20 аминокислот, которые
участвуют
в по-

строении белка,
существует
своя аминоацил-тРНК-синтетаза. Таким

образом, в прокариотических клетках
существует
20 различных ами-

ноацил-тРНК-синтетаз.
Однако в эукариотических клетках ситуация

сложнее, и в
первую
очередь из-за существования специальных амино-

ацил-тРНК-синтетаз в
хлоропластах
и митохондриях (в дополнение к

основным цитоплазматическим синтетазам).

Что касается различных видов
тРНК,
то их
всегда
больше, чем число

аминокислот и аминоацил-тРНК-синтетаз. Так, в бактериях (Е.
coli)

имеется не менее 40 видов тРНК, кодируемых различными генами.

Это значит, что несколько различных
тРНК
могут
узнаваться одной и

той же аминоацил-тРНК-синтетазой и, соответственно, соединяться с

одной и той же аминокислотой; такие
тРНК
называются
изоакцептор-

ными.
Разные изоакцепторные
тРНК
могут
узнавать разные кодоны

для данной аминокислоты. Например, в Е.
coli
имеется пять различных

лещиновых
тРНК,
с антикодонами CAG, GAG, NAG
(N

неидентифи-

цированное производное одного из
оснований),
САА и
А*АА,
узнающих

шесть лейциновых кодонов; из них TPHKIL6U
узнает
лейциновый кодон

CUG
(антикодон CAG), а TPHKS6"
узнает
лейциновые кодоны UUA и

UUG
(антикодон
А*АА,
где А*

неидентифицированное производное

А). В некоторых
случаях
изоакцепторные тРНК, различающиеся

по
первичной
структуре,
могут
узнавать одни и те же кодоны, имея

похожие антикодоны. В цитоплазме эукариотических клеток ситуация

аналогична.

Эукариотические митохондрии имеют собственный набор тРНК,

который значительно проще такового цитоплазмы: здесь
существует

всего
23—24
вида тРНК, обладающих различными антикодонами,

и
они оказываются достаточными для узнавания
всех
61—62
смысловых

кодонов митохондриальных
мРНК.

2.
СТРУКТУРА тРНК

Первичная
структура

В 1965 г.
Р.
Холли с сотр. сообщили о нуклеотидной последовательности

первой молекулы тРНК. Это была аланиновая
тРНК
дрожжей (рис. 12).

С
тех пор были расшифрованы многие десятки последовательностей

Различных
тРНК
из разнообразных источников. Все они имеют ряд

общих
черт.

29

1
10 20

pG-G-G-C-G-U-G-U-mG-G-C-G-U-A-G-hU-C-G-G-hU-

2
зо 40

-A-G-C-G-C-mj3-C-U-C-C-C-U-U-I-G-C-m_I:t_-G-G-

50
60

-G-A-G-A-G-G-U-C-U-C-C-G-G-T-T-C-G-A-U-U-

TO
76

-C-C-G-G-A-C-U-C-G-U-C-C-A-C-C-AQH

Рис.
12.
Нуклеотидная последовательность аланиновой
тРНК

дрожжей
(тРНКГ"1)
(по R. W.
Holley
et al.
Science,
1965,
v. 147,

р.
1462-1465;
J. R.
Penswick
et al.
FEBS
Lett.,
1975, v. 50,

p.
28-31):

волнистой
линией выделен антикодоновый триплет; сплошной


подчеркнуты консервативные (инвариантные) нуклеотиднЫе остатки
и

последовательности;
пунктирной

остатки,
в
которых консервированы

либо
пуриновые, либо пиримидиновые основания
в
других
тРНК

Длина цепей
тРНК
варьирует
от 74 до 95
нуклеотидных остатков.

Все
тРНК
кончаются на 3'
-конце
универсальной тринуклеотидной по-

следовательностью ССАоН; именно концевой инвариантный аденозин

акцептирует
аминокислотный
остаток
при
образовании
аминоацил-тРНК.

Антикодоновый триплет находится приблизительно в середине цепи

тРНК
(IGC
в
положении
34—36
на рис. 12). С 5'-стороны от него всегда

находятся два пиримидиновых остатка,
а
с 3'-стороны —часто два пури-

новых остатка, хотя второй остаток может быть
и
пиримидиновым,

как
в
случае
тРНКА1а
(рис. 12). Эти
семь нуклеотидных остатков

вместе образуют так назьшаемую «антикодоновую
петлю»
(АС-петлю),

взаимодействующую
с
мРНК
и
обладающую характерной пространст-

венной
структурой (см. ниже).

Приблизительно
на расстоянии
1/3
общей длины цепи
тРНК
от ее

3'-конца располагается общий для большинства
тРНК
участок
с
после-

довательностью СТЧ'С или, гораздо реже, GU^C
(Gm'^^C
у
архе-

бактерий),
фланкируемый
с
обеих сторон пуриновыми остатками.

В инициаторных
тРНКр*
эукариотов он заменен на
GAVC
или GAUC.

Это —наиболее четко выраженная протяженная универсальная после-

довательность
тРНК.

митохондриальных
тРНК,
однако, она сильно

варьирует.)

Необходимо отметить также довольно консервативные части" после-

довательности
в
пределах
от
8-го
до
25-го
нуклеотидных остатков

цепей
тРНК.
Здесь имеются также инварианты, такие как
U
или
его

тиопроизводное (s4U)
в
положении 8, G или его метальное производное

(m2G)
в положении 10, AG или АА в положении 14—15,
GG
в положениях

17—21, AG
в
положениях
21—24
различных
тРНК.

Уже
из
рассмотрения последовательности одной
тРНК
(рис.
12)

видно,
что, в дополнение к четырем главным типам нуклеотидных остат-

ков
(А,
G,
С,
U),
полинуклеотидная цепь
тРНК
характеризуется наличием

разнообразных модифицированных нуклеозидов, часто называемых

«минорными».
Они
образуются
в
результате
посттранскрипционной

зо

энзиматической модификации обычных нуклеозйдных остатков в спе-

цифических
местах
полинуклеотидной цепи
тРНК..
К настоящему вре-

мени
идентифицировано несколько десятков различных модифицирован-

ных нуклеозидов в
тРНК.
Риботимидин (5-метилуридин, обозначаемый

как
Т или m5U) и псевдоуридин (5-рибофуранозилурацил, W)
присутству-

ют почти во
всех
тРНК
и особенно характерны для универсальной

последовательности GT^C (рис. 13). 5,6-дигидроуридин (hU или D)

тоже
является почти универсальным «минорным» остатком, особенно в

районе 15-го
—24-го
нуклеотидов цепи. У бактерий в положении 8 типи-

чен 4-тиоуридин (^U). Наиболее распространенные «минорные» остат-

ки—различные метилированные производные обычных нуклеозидов,

такие как 1-метилгуанозин
(m'G),
№-метилгуанозин
(m2G),
№,

№-диметилгуанозин
(m^G),
7-метилгуанозин
(m7G),
2'-О-метилгуанозин

(G™), 1-метиладенозин (т'А), 2-метиладенозин (m2A), №-метиладенозин

(m6A), Z-О-метиладенозин (Am), 3-метилцитидин
(m3C),
5-метилцити-

дин (тбС), 2'-0-метилцитидин (С™) и т. д. (рис. 14).

В первом положении антикодона
могут
быть немодифицированные

G
и С, но практически не бывает А и U. А в первом положении антико-

дона обычно дезаминирован, таким образом представляя собой I

(рис.
15); I здесь особенно типичен для
тРНК
эукариот
(тРНК11е
,
тРНКУа1,

TPHKSer,
тРНКРго, тРНКТЬг, тРНКА1а,
тРНКАг8).
Что касается U, то он в

первом положении антикодона представлен 5-метоксиуридином (то5!^

или
5-карбоксиметоксиуридином (уридин-5-оксиуксусная кислота;

cmosU или V) в
тРНКА1а,
TPHKS"
И
TPHKVIÜ
бактерий, 5-метиламино-

метил-2-тиоуридином
(mnm5s2U)
в
TPHKGIU
И
ТРНК
Lys
бактерий,

5-(метоксикарбонилметил)-2-тиоуридином (mcm5s2U) в
TPHKG1U
И

TPHKLys
грибов или 5-(метоксикарбонилметил)уридином (mcm6U) в

тРНКАг*
грибов. Немодифицированный U обнаружен лишь у одной из

тРНК
°'У некоторых бактерий и у одной из дрожжевых
тРНКЬеи,
но весьма

типичен для митохондриальных
тРНК
как грибов, так и млекопитающих.

Для первого положения антикодона таких
тРНК,
как
TPHKASP, TPHKAS°,

TPHKHIS,
тРНКТуг
бактерий и животных оказался характерным гипермо-

дифицированный
G —так называемый "кьюозин (Q), который является

7-
{[(1/мс-4,5-диокси-2-циклопентен-1-ил) амино]метил} -7-деазагуанозином

Особым типом модификации («гипермодификацией») часто характе-

ризуется пуриновый нуклеозид антикодоновой петли, примыкающий

к
антикодону с 3'-стороны. Например, остаток, фланкирующий анти-

кодон с 3'-стороны, представлен Ы6-изопентениладенозином (ieA) в эука-

риотических
тРНКСу\
TPHKS"
И
тРНКТуг
или №-изопентенил-2-метил-

тиоаденозином
(ms2ieA)
в аналогичных
тРНК
бактерий, или №-(трео-

нинокарбонил)аденозином,
обозначаемым также как
N-[N-(9-
ß
-D-ри-

бофуранозилпурин-6-ил) карбамоилтреонин (teA), в
тРНК11е, тРНКТНг,

TPHKLys,
тРНКМе'
как эукариот, так и бактерий (рис. 16). Еще более

31

о

HIT^NH

QJyJ

RlBOSE

Псевдоуридин
(¥)
RlBOSE

Дигидроуридин
(D или hü)

I

RlBOSE

4-Тиоуридин
(s
U)
RlBOSE

Риботимидин
(Т)

Рис. 13.
Модифицированные производные уридина, широко встречающие-

ся
в
тРНК

н3о
н3с

1-Метилгуанозин

(m1G)

HjN
но-ф

но
он

М2-Метилгуаноэин Ы2,ы2-Диметилгуаноэин 7-Метилгуанозин

(m2G)

NH

То
NH2

N

ч

НО
(m?G)

NHCH3

НО ОСН3

но
он

2'-0-Метилгуанозин 1-Метиладенозин

(От)
< А)
HO
OH

2-Метиладенозин

(m2A)

н3сч
NH

НО
0СН5

2'-О-Метиладенозин

(Am)
НО
ОН

З-Метилцитидин
НО
ОН

N
-Метиладенозин

(т«А)

NH2

НО
ОН

5-Метилцитидин
HO 0CH3

2'-0-Метилцитидин

(Cm)

Рис.
14. Метилированные производные гуанозина, аденозина и цитидина,

встречающиеся в
тРНК

32

ни

Ribose

МЕТОКСИУРИДИН (mo5U)
О
О

HNAYOCH2-COOH
HNX,CH2-NH-CH3

Ribose
Ribose

5-КАРБОКСИМЕТОКСИУРИДИН 5-МЕТИЛАМИН0МЕТИЛ-

(cmo5u
ИЛИ V)
-2-ТИ0УРИДИН (mnm5s2U)

N

Ribose

5-(МЕТОКСИКАРБОНИЛМЕТИЛ)-

-2-ТИОУРИДИН (mcm5s2U)
Ribose

5-(МЕТ0КСИКАРБОНИЛМЕТИЛ)УРИДИН

(mcm5u)

ИНОЗИН
(I)

КЬЮОЗИН
(Quo ИЛИ Q)

Рис.
15.
Модифицированные нуклеозиды, встречающиеся
в
первом

положении
антикодона
тРНК

«гипермодифицировано» это положение в цепи
тРНКРЬе
всех эукариот:

оно
представлено так называемым уайбутозином (yW или Y) или его

оксипроизводным
(oyW).

Вторичная
структура

Рассмотрение уже первой расшифрованной первичной структуры
тРНК

(тРНКА1а
дрожжей) открывает ряд интересных черт, касающихся воз-

можного складывания цепи во вторичную
структуру.
Так, видно

(см.
рис. 12), что имеется значительная комплементарность 5'-концевого

участка (положения 1—7)
участку,
близкому к З'-концу цепи (положения

66—72), при их антипараллельном расположении. Кроме того, три

внутренние секции цепи
тРНК
оказьгоаются взаимокомплементарными

при
складывании их на себя,
будучи,
таким образом, способными

зз

го
NH-CH2-CH=C.C

I

Ribose

N
-И30ПЕНТЕНИЛАДЕН03ИН

(i6A)
H3CS-

Rib

ose

2-МЕТИЛТИ0-№-

-И30ПЕНТЕНИЛАДЕН03ИН

(ms2i6A)
H
C-N-t-CO2H

И6-(ТРЕ0НИН0КАРБ0НИЛ)АДЕН03ИН

NHCOOCH3

<}нсоосн3

T
\

CH3
Ribose

УАЙБУТ03ИН (yW ИЛИ Y)
l)IHC00CH3

CHCOOCH3

HCOOH

н2 о н

CH3
Ribose

ПЕР0КСИУАЙБУТ03ИН
(oyW)

Рис.
16. «Гипер-модифицированные» нуклеозиды, встречающиеся в положении,

непосредственно примыкающем к антикодону с З'-стороны

образовывать шпилькообразные структуры; это участок с 10-го по 25-й

остаток, участок с
27-го
по 43-й остаток и участок с
49-го
по 65-й остаток,

где две терминальные четырех- пяти-нуклеотидные последовательности

каждого отрезка комплементарны
друг
другу.
Спаривание указанных

комплементарных последовательностей
дает
структуру,
схематически

изображенную на рис. 17 и получившую название структуры типа

клеверного листа. Наиболее замечательным оказалось то, что нуклео-

тидные последовательности
всех
тРНК,
изученных с тех пор, характе-

ризовались теми же правилами самокомплементарности и, соответ-

ственно,
могли быть сложены в полностью аналогичные «клеверные

листья». Части «клеверного
листа»
были обозначены как
акцепторный,

или
А А
черешок
с универсальной 3'-концевой последовательностью

ССА, акцептирующей аминокислотный остаток;
дигидроуридиловая,

или
D
шпилька
с соответствующей петлей, несколько варьирующей по

длине и содержащей, как правило (но не обязательно), от одного до

пяти
дигидроуридиловых остатков,
антшодоновая,
или АС
шпилька
с

антикодоновои
петлей постоянной длины в семь нуклеотидных остатков

и
тимидилпсевдоуридиловая,
или
Т
шпилька,
несущая петлю с.универсаль-

ной
последовательностью ОТЧ'СдА. В
дополнение,
в «клеверном
листе»

выделяют также
вариабельную
или V
петлю,
располагающуюся
между

антикодоновои
и Т-шпильками; в
тРНКА1а
она мала (5 нуклеотидных

остатков), но у
других
тРНК
она может достигать длины
15—20
остатков

(TPHKLeu,
TPHKSer, бактериальная
тРНКТуг).

34

Рис.
17.
Схема вторичной структуры

аланиновои
тРНК
дрожжей («клевер-

ный
лист»)
(по
R.
W.
Holley
et al.

Science 1965,
v.
147,
р.
1462-1465)

Рис.
18.
Фрагмент скелетной модели

двойной
спирали
РНК
(А-форма),

показывающей только ковалентные

связи:

мерху
— вид сбоку (приведены семь пар

нуклеотидных остатков; участки полинук-

леотидного остова, обращенные к зрителю,

изображены утолщенными линиями); »ни-

зу — вид с торца спирали, демонстрирую-

щий
стэкинг оснований (для ясности при-

ведены лишь две нуклеотидные пары;

пара, обращенная к зрителю, изображена

утолщенными линиями; пунктирными

линиями
показаны водородные связи)

IGC
,

С

G

C-G

C-G

U- А

С

G А G

G

G
G.CGC

С
ÜGCG

hUGA
m|G

m'G

U
G


T

UCCGG

ÄGGCC.

G- С

U U

G-C

C-G

G -U

G-C

pG -C

А

С

С

А
С

G

. А

он

Дрожжевая
тРНКА|а
з'

В структурном отношении спаренная (двутяжевая) часть каждой

шпильки
и черешка представляет собой двойную спираль. Двойная

спираль РНК характеризуется 11 парами нуклеотидных остатков на

виток. Параметры этой спирали близки к таковым А-формы ДНК

Это и есть основной элемент вторичной
структуры
тРНК
(рис. 18).

Кроме
канонических (Уотсон

Криковских) пар оснований G

С и

А

U, в двуспиральных
участках
тРНК
нередко реализуется пара G

U,

наиболее близкая по пространственным параметрам к каноническим

парам (рис. 19; см. цветную вкладку).

35

Рис.
20.
Антикодоновая петля фенилаланиновой
тРНК
дрожжей: шаростержневая

модель (водороды
не
показаны)

ход
полинуклеотидного остова показан черным цветом; три нуклеотидных остатка антико-

дона
заштрихованы

Другой характер носит вторичная
структура
неспаренных участков,

таких как петли
и
акцепторный оССА-конец. Здесь часто имеется
од-

носпиральное расположение нескольких остатков, поддерживаемое

межплоскостными взаимодействиями («стэкинг») оснований. Структура

антикодоновой петли представляет особый интерес
(рис. 20): три

основания
антикодона
и два
последующих основания, примыкающие
к

нему
с
3'-стороны, находятся
в
едином «стэкинге»
друг
с
другом
и обра-

зуют
однотяжевую правозакрученную спираль
со
своеобразными
па-

раметрами,
так что
первое основание антикодона помещается
на
самой

36

верхушке шпильки, а группы, образующие водородные связи, у
всех

трех
оснований антикодона оказываются экспонированными
наружу.

Последнее, очевидно, принципиально важно для взаимодействия с кодо-

ном
мРНК.
Черты первичной структуры антикодоновой петли способст-

вуют
поддержанию ее пространственной структуры описанного типа:

гипермодифицированное пуриновое основание, непосредственно примы-

кающее к антикодону с 3'-стороны, а также следующее основание,

часто являющееся пурином, должны обеспечивать стабильные меж-

плоскостные взаимодействия в однотяжевой спирали, а два
«маленьких»

(пиримидиновых) основания с 5'-стороны антикодона, и особенно при-

мыкающий к нему инвариантный U, создают резкий перегиб цепи

(между антикодоном и U) и поддерживают конформацию петли, в

частности за счет водородной связи
между
азотом инвариантного U и

фосфатной группой 3-го остатка кодона.

Интересно,
что
похожую
односпиральную конформацию с аналогич-

ным
«уридиновым поворотом» имеет Т-петля (там роль инвариантного

U играет 40-

Третичная
структура

Впервые трехмерная
структура
тРНК
была расшифрована для дрожже-

вой
тРНК
Phe с помощью рентгеноструктурного анализа ее кристаллов

одновременно в США группой Александра Рича и в Великобритании

группой Аарона Клуга в 1974 г. Многочисленные косвенные данные,

а затем и прямая расшифровка трехмерных
структур
еще нескольких

тРНК
показали, что основной рисунок складывания цепи
тРНК
в тре-

тичную
структуру
является универсальным. Схематически это склады-

вание можно представить следующим образом. Акцепторный черешок

и
Т-шпилька располагаются вдоль одной
оси,
формируя
как
бы непрерыв-

ную двойную спираль из 12 пар нуклеотидов; антикодоновая шпилька

и
дигидроуридиловая шпилька тоже располагаются вдоль одной оси и

формируют
другую
двойную спираль, включающую 9 пар нуклеотидов;

эти
две спирали ориентируются
друг
по отношению к
другу
приблизи-

тельно под прямым
углом
так,
что дигидроуридиловая петля оказывается

сближенной с Т-петлей и скрепленной взаимодействием GG-инварианта

с Ч'С-инвариантом (рис. 21). Получается что-то вроде буквы L, где

вершины
двух
ее ветвей представляют собой антикодон и акцепторный

3'-конец. На дигидроуридиловую спираль у внутреннего
угла

L-образной молекулы накладывается еще короткая однотяжевая пере-

мычка
между
акцепторным черешком и дигидроуридиловой спиралью

(остатки 8-9), часть дигидроуридиловой петли и дополнительная вари-

абельная петля, в
результате
чего образуется так называемое
«ядро»

молекулы с большим количеством третичных взаимодействий. Это

ядро можно видеть как сгущение и переплетение отрезков цепи в районе

угла,
особенно с его внутренней стороны, на схематическом рисунке

модели дрожжевой
тРНКРЬе
(рис. 22).

Длина каждой ветви L-образной молекулы
тРНК
около 7 нм, а тол-

щина
молекулы около 2 нм. Расстояние
между
антикодоном и акцептор-

37

АС шпилька

CmAA

и

Cm
А

А- Г

G

m'C

А

U

С

G V петля

,С-6А6,

G G А m|G 1
m
G

G
GAGCy
CU т^с

bU С Cl CirfG
m5CUGUG
Q

)шпилька
,. *

У
* TV
шпилька

А

U

G

U
D
шпилька

G-
С

С-
G

pG-
С

А

С

С

А
он

ДА
спираль
АС шпилька

Gn/A

и
Y

Cm А

А-У

G-m5C

A-U

C-G

гС- G

С

nTG А _ v петля

G-C \ bmrG

А

U \ и

G

С \ С

А А \

G G \

г hU \

G hU \

С У Т . \

G G U G Um'CUU AGGCGp

m'A CÄCÄGAAUÜCGCACCAOH

и
с

ДА
спираль

TV
шпилька

РИС.
21. Схема складывания спиральных участков
тРНК
(дрожжевая
тРНК
)

в третичную
структуру
(по S. H. Kim et al. Science, 1974, v. 185, р.
435-440)

ным
концом составляет
7,6—7,8
нм. Все три основания антикодона на

вершине одной из ветвей обращены на внутреннюю сторону
угла

L-образной молекулы.

В создании и поддержании третичной структуры
тРНК
реализуется

много неканонических (не Уотсон

Криковских) взаимодействий
между

основаниями
цепи. Прежде всего,
угол
L-образной молекулы
тРНК

крепится как межплоскостными взаимодействиями, так и взаимодействи-

ями
через водородные связи
между
дигидроуридиловой петлей и Т-пет-

лей. Взаимодействие
между
инвариантами G19 и С56

Уотсон

Кри-

ковского типа (см. рис. 19, б), но взаимодействие
между
инвариантами

G18 и Ч*^ очень своеобразно и включает водородные связи атома О

при
С4 пиримидинового кольца W как с
N1,
так и с N при С2 пуринового

кольца G (рис. 23, а; см. цветную вклейку). Кроме того, имеется необыч-

ное сильное межплоскостное взаимодействие
между
тремя гуанози-

новыми остатками в том же
углу:
G57 оказывается вставленным

(интеркалированным)
между
G18 и G19. Более того, G57 через N при

С2 взаимодействует водородными связями с рибозами G18 и G19, а через

N7

водородной связью с рибозой W 55.

Еще более сложные третичные взаимодействия возникают в
«ядре».

Как
уже отмечалось, здесь переплетаются четыре разных участка поли-

нуклеотидной цепи. Характерна неканоническая пурин-пуриновая пара

G

А (или А

G, в зависимости от вида тРНК)
между
остатками 26 и 44

(рис.
23, 6). Спаривание G

С (или, в
других
тРНК,
А

U)
между
остат-

ками
15 и 48 необычно для двойных спиралей с антипараллельным рас-

положением цепей; здесь направление цепей параллельное (рис. 23, в).

Еще более необычным является спаривание А с U
между
остатками

14 и 8, где в образовании водородной св,язи
участвует
N7 пуринового

38

Gm34

АНТИКОДОН
и
зз

А76
m7G46
s

л

с

э

с

3

о

х

м

с

Э

с

3

О

3'-
конец

5'-коней
Y55

ДА
спираль

Т шпилька

РИС.
22. Схема третичной структуры
тРНК
(дрожжевая
тРНК
)

(по
А. Rieh, S. H. Kim, Scientific American, 1978, v. 238, р. 52-62)

кольца (рис. 23, г). Для этой части молекулы характерны также тройные

водородные взаимодействия оснований, такие как U • А • А (или, в дру-

гих
тРНК,
эквивалентные им G •
С
• G или U • А •
G)
между
остатками

12, 23 и 9, соответственно (рис. 24,
верх;
см. цветную вклейку) и

С

G

G
(или эквивалентный U • А • А)
между
остатками 13, 22 и 46,

соответственно (рис. 24, низ). Стереоизображение масштабной атомной

модели
тРНК
дано на рис. 25 (см. цветную вклейку).

3.
АМИНОАЦИЛ-тРНК-СИНТЕТАЗЫ

Несмотря
на универсальность основных черт пространственной струк-

туры
тРНК,
аминоацил-тРНК-синтетазы
оказались довольно различными

белками в зависимости от их аминокислотной специфичности. В основ-

ном
это крупные белки с молекулярной массой приблизительно от

100000
до
400000
дальтон, обладающие четвертичной структурой, хотя

среди них имеются и мономерные ферменты. Четвертичные структуры

синтетаз построены из
двух
или четырех белковых субъединиц, которые

39

могут
быть или идентичны, или различны. Например, тирозил-тРНК-

синтетаза бактерий построена из
двух
идентичных субъединиц с молеку-

лярной
массой
47000
дальтон каждая, а метиониновая синтетаза бактерий

состоит из
двух
идентичных субъединиц с молекулярной массой

около
80000—90000
дальтон каждая (тип а2). Фенилаланиновая амино-

ацил-тРНК-синтетаза бактерий, так же как
и
дрожжей, построена из четы-

рех субъединиц
двух
видов, с молекулярными массами около
50000
и

60000
дальтон (тип а2 ßz)- Такие аминоацил-тРНК-синтетазы бактерий,

как
валиновая, лейциновая и изолейциновая, являются мономерными

ферментами (тип и,), т. е. представляют собой одну полипептидную

цепь с молекулярной массой около
110000
дальтон. В последнем случае,

однако,
полипептидная цепь состоит, по-видимому, из
двух
гомологич-

ных частей, формирующих два похожих домена с массой около

50000—60000
дальтон каждый. В то же время цистеиновая и
глюта-

миновая аминоацил-тРНК-синтетазы бактерий построены из одной

полипептидной цепи (тоже тип а,) с молекулярной массой
40000—

60000
дальтон и, скорее всего, не имеют подразделения на два гомоло-

гичных участка. Мономером является и аргинил-тРНК-синтетаза, имею-

щая
молекулярную массу около
70000
дальтон.

Как
правило, синтетазы одной и той же аминокислотной специ-

фичности,
выделенные из разных источников, имеют
похожую
четвер-

тичную
структуру
и близкие размеры полипептидных цепей. Однако

синтетазы эукариотических клеток, по сравнению с прокариотическими,

характеризуются несколько большим размером субъединиц.

Несмотря на отмеченное разнообразие, для большинства аминоацил-

тРНК-синтетаз можно предложить обобщенную
схему
их субъединичной

или доменной структуры. Во всяком случае, если не всегда, то часто син-

тетазы с молекулярной массой около
100000
состоят либо из
двух

субъединиц, либо из
двух
похожих доменов. Синтетазы с большими

молекулярными массами (около
200000)
являются как бы «удвоенными»

ферментами вышеуказанного типа. Таким образом, если основной блок

(домен или субъединица) фермента имеет молекулярную массу от

35000
до
60000,
то многие аминоацил-тРНК-синтетазы оказываются

построенными по схеме:
(35000—60000)г
X
1
или 2 Однако основной блок

может быть в некоторых случаях значительно крупнее; например,

аланиновая синтетаза бактерий построена из четырех или
двух
идентич-

ных субъединиц с молекулярной массой
100000
дальтон каждая, причем

в ее аминокислотной последовательности не наблюдается повторов.

С
другой
стороны, уже приводился пример цистеиновой аминоацил-

тРНК-синтетазы,
которая, по-видимому, не является ферментом выше-

указанного двухсубъединйчного или двухдоменного типа. Аргинил-

тРНК-синтетаза тоже не обнаруживает черт двухдоменной организации.

Как
бы то ни было, согласно функциональным тестам, большинство

аминоацил-тРНК-синтетаз (но не аргининовая!) обладают двойным

набором субстратсвязывающих мест, т. е. они димеры также и в функ-

циональном смысле. Активные центры, однако, не полностью независи-

мы,
а оказывают заметное влияние
друг
на
друга
в полном димерном

(или
двухдоменном) ферменте, проявляя известную кооперативность.

Необходимо отметить ряд особенностей эукариотических, и в пер-

40

вую очередь животных, аминоацил-тРНК-синтетаз. Как и многие
другие

белки белоксинтезирующего аппарата эукариотической клетки (см.,

например,
EF-1
в
разделе
В. IL2), эукариотические синтетазы, и особенно

таковые клеток млекопитающих, организованы в крупные многофер-

ментные комплексы, или агрегаты. В клеточных экстрактах они чаще

всего обнаруживаются как компоненты с коэффициентами седиментации

от 12S до 30S и молекулярными массами от
3

106 до 106 и более дальтон.

Одна и та же синтетаза может содержаться в комплексе различной

величины

например,
лизил-тРНК-синтетаза печени крысы обнаружи-

вается в компонентах 24S, 18S и 12S. Комплексы
могут
быть выделены

и
очищены. Так, из ряда клеток млекопитающих выделяется комплекс

с молекулярной массой около 106 дальтон, содержащий семь амино-

ацил-тРНК-синтетаз, специфичных для лизина, аргинина, глютамина,

глютаминовой кислоты, лейцина, изолейцина и метионина. Однако

существование в виде комплекса не обязательно для их активности:

с одной стороны, они
могут
существовать в клетках и в индивидуальном

виде, а с
другой,
в составе комплекса они
работают
независимо
друг
от

друга.
Помимо синтетаз, в составе комплексов
могут
быть
другие
белки,

обслуживающие белоксинтезирующий аппарат клетки.

Другая
особенность эукариотических аминоацил-тРНК-синтетаз со-

стоит в том, что значительная их доля оказывается ассоциированной

непосредственно с белоксинтезирующими частицами клетки (полирибо-

сомами).
Ассоциация довольно лабильна и обратима, но, тем не менее,

в каждый данный момент большая часть аминоацил-тРНК-синтетаз

клетки, по-видимому, сконцентрирована при функционирующих

рибосомах. Эта особенность эукариотических систем обусловлена,

скорее всего, молекулярными свойствами ферментов. Действительно,

было показано, что в отличие от прокариотических аминоацил-тРНК-

синтетаз, их эукариотические аналоги имеют довольно сильное неспе-

цифическое сродство к высокомолекулярным РНК, включая
мРНК
и

рибосомные РНК Именно это сродство (РНК-связывающая способ-

ность) эукариотических синтетаз может обеспечивать их частичную

компартментализацию на белоксинтезирующих частицах.

4
АМИНОАЦИЛИРОВАНИЕ
тРНК

Присоединение аминокислоты к 3'-концу
тРНК,
катализируемое амино-

ацил-тРНК-синтетазой, сопряжено с расщеплением АТФ. Суммарная

реакция
процесса может быть записана как

Аа + АТР +
tRNA
«
Aa-tRNA
+ АМР + РР,,

где Аа —аминокислота; Aa-tRNA

аминоацил-тРНК;
РР,

неоргани-

ческий пирофосфат. Оказалось, что фермент катализирует две различ-

ные реакции, являющиеся
двумя
последовательными стадиями выше-

описанного процесса.

Реакция
первой стадии, катализируемая аминоацил-тРНК-синтета-

здй

это так называемая реакция
активации
аминокислоты,
где карбок-

сильная группа аминокислоты
атакует
связь
между
а-и ß-фосфатными

41

(1)
H3N-
P
/° P 9 ? н

-CH-c' + "O-P-O-P-O-p-O-CH,
NH2

R
О

Hsft-iH-<

o-p-o-

0'

OH
OH
OH
OH

NH2

(2)

tRNAcc

CH2n

О

OH
0

oo

I

R-CH

I

+NH,
OP
_r

O-P-0

I

0

OH
OH

Рис.
26.
Реакции активации аминокислоты
(1) и
акцептирования амино-

ацильного остатка молекулой
тРНК
(2),
катализируемые аминоацил-тРНК-

синтетазой

остатками АТФ, в
результате
чего образуется смешанный ангидрид

аминоациладенилат и неорганический пирофосфат (рис. 26, 1):

Аа + АТР . '
Аа-АМР
+ РР, (1)

Эта реакция обратима и легко прослеживается с помощью теста пиро-

фосфатного обмена: если в реакционную смесь добавить [32Р]пирофос-

фат, то в ней скоро обнаруживается [32Р]АТФ. Образовавшийся в реакции

(1) аминоациладенилат остается связанным с ферментом и не освобож-

дается в раствор.

Указанная реакция, а следовательно, и суммарная реакция оказы-

вается сильно сдвинутой вправо, в сторону синтеза аминоациладенилата

и
аминоацил-тРНК, благодаря протеканию реакции гидролиза неорга-

нического пирофосфата, катализируемой пирофосфатазой. Таким обра-

зом,
тот факт, что в
результате
реакции активации аминокислоты осво-

бождается пирофосфат, далее гидролизуемый до неорганического орто-

фосфата, играет важную роль в энергетическом обеспечении направлен-

ности всего процесса.

Реакция
второй стадии, катализируемая тем же
ферментом,

соб-

ственно реакция
акцептирования
аминокислоты,
где 2'- или З'-гидроксил

рибозы 3'-концевого аденозина
тРНК
атакует ангидридную группировку"

аминоациладенилата с образованием сложноэфирной связи
между

аминоацильным остатком и рибозой
тРНК
и с сопутствующим осво-

бождением АМФ (рис. 26,2):

Аа-АМР
+
tRNA
, Е '
Aa-tRNA
+ АМР (2)

Случай аргинил-тРНК-синтетазы представляет собой, по-видимому,

исключение: здесь не удается обнаружить стадии образования амино-

ациладенилата как промежуточного продукта.

Интересно,
что разные аминоацил-тРНК-синтетазы обладают разной

специфичностью в отношении гидроксила рибозы,
участвующего
в реак-

ции
трансацилирования. Например, фенилаланил-, лейцил-, изолейцил-,

валил-,
метионил-,
аргинил-тРНК-синтетазы присоединяют аминокислоту

к
2'-гидроксилу, в то время как серил-, глицил, треонил-, гистидил-, про-

лил-тРНК-синтетазы

к
З'-гидроксилу. Тирозиновая и цистеиновая ами-

ноацил-тРНК-синтетазы катализируют реакцию как с 2'-, так и с З'-гидро-

ксилом. Для дальнейшего участия образовавшейся аминоацил-тРНК в

трансляции это не имеет принципиального значения, так как в водном

растворе наблюдается легкая спонтанная миграция (через образова-

ние
2',3'-цикла) аминоацильного остатка
между
2'- и З'-гидро-

ксилами, с установлением равновесия
между
обеими формами

(рис.
27).

Таким образом, из вышеприведенного описания реакций, приво-

дящих к аминоацилированию
тРНК,
следует,
что фермент аминоацил-

тРНК-синтетаза использует три субстрата различной химической

природы: АТФ, аминокислоту и тРНК. Соответственно, он должен

иметь три различных субстратсвязывающих места. АТФ является

универсальным субстратом
всех
аминоацил-тРНК-синтетаз, в то время

43

I

о

I

о
он

с=о

I

H-C-NH2

R
Н2С

V

н


V чон

R
NH2
I

о

I

но

о=с

I

H-C-NH2

R

Рис.
27.
Спонтанная миграция аминоацильного
остатка
между
2'- и 3'-
поло-

жениями рибозы концевого аденозина тРНК
через
образование коротко-

живущего
промежуточного
соединения.

как
по
отношению
к
аминокислоте
и к
тРНК
каждая аминоацил-

тРНК-синтетаза
проявляет высокую специфичность.

Уже отмечалось,
что во
многих случаях аминоацил-тРНК-синте-

тазы являются димерами
или
псевдодимерами
и,
соответственно,

несут
два
набора субстратсвязывающих мест. Субстратсвязывающие

места как
в
пределах каждой субъединицы (или эквивалентного
ей

домена),
так и на
разных субъединицах (или доменах) оказываются

взаимозависимыми.
Прежде всего, часто наблюдается синергизм
в

связывании
различных субстратов: связывание одного субстрата об-

легчает
связывание
другого.
С
другой
стороны,
в
связывании
двух

молекул
тРНК
отмечается отрицательная кооперативность, т. е. связы-

вание одной молекулы
тРНК
делает
менее прочным связывание
дру:

гой молекулы
тРНК.

Рассмотрим примерную
схему
последовательности присоедине-

ния
субстратов
к
димерному ферменту, изображенную
на
рис.
28.

Если
начать
со
свободного
от
субстратов фермента (верхняя часть

рисунка),
то
первыми стадиями часто является связывание малых

субстратов — АТФ
и
аминокислоты,
— причем связывание одного

стимулирует связывание
другого
(синергизм). Между связанными

субстратами
на
ферменте происходит реакция образования амино-

ациладенилата
с
освобождением пирофосфата
в
раствор. Связывание

малых субстратов
и
образование аминрациладенилата
в
свою
оче-

редь стимулируют связывание
тРНК,
в
результате
чего происходит

реакция
аминоацилирования
тРНК
на
ферменте
и
освобождение

АМФ
в
раствор. Аминоацил-тРНК, пока она одна на фермент, диссо-

циирует
от
фермента довольно медленно,
и
здесь стимулирующую

роль
в ее
диссоциации играет связывание второй молекулы
тРНК.

Получается цикл, изображенный
на
нижней части рис.
28, где в

работающем ферменте один из дентров связывания
тРНК
перманент-

но
занят
и,
следовательно, фермент проявляет реактивность лишь

половины
своих субстратсвязывающих мест.

В естественных условиях, когда фермент циклически работает

в
избытке субстратов, имеет место, по-видимому, тот цикл, который

изображен
на
нижней части рис. 28. Начнем
с
состояния 1, когда ак-

44

тивный центр одной субъеди-

ницы
(или домена) занят ами-

ноацил-тРНК,
а
другой
пуст.

Следовательно, лишь суб-

стратсвязываюшие места дру-

гого активного центра фермен-

та способны связывать лиган-

ды. Последовательное или

независимое связывание малых

субстратов

АТФ и аминоки-

слоты (состояния 2 и 3)

при-

водит к образованию фермент-

связанного аминоациладенила-

та (состояние 4), что стимули-

рует
посадку
тРНК
на второй

активный центр фермента

(состояние 5).
Ввиду
отмечен-

ной
выше отрицательной

кооперативности, связывание

тРНК
со вторым активным

центром ослабляет удержание

аминоацил-тРНК
в первом

активном центре, так что по-

следняя диссоциирует в раст-

вор, оставляя фермент опять с

одним занятым и другим ва-

кантным активным центром

(состояние 6). Таким образом,

поочередно работает то один,

то
другой
активный центр ди-

мерного (или двухдоменного)

фермента. Конечный продукт


аминоацил-тРНК

не
осво-

бождается в раствор по завер-

шении
реакций ее синтеза, а

«ждет»,
пока вторая
субстрат-

ная
тРНК
не
поступит
во
второй

активный центр.
tRNA
ATP

РР
АА

Рис.
28. Примерная схема последовательности

событий при
функционировании
двухдоменной

(или
димерной) аминоацил-тРНК-синтетазы

(по
Э. Г. Малыгину и Л. Л. Киселеву. Биоорга-

ническая
химия, 1982, т. 8, с.
725—746)

5.
СПЕЦИФИЧНОСТЬ
АМИНОАЦИЛИРОВАНИЯ
тРНК

Специфичность
по
отношению
к
аминокислоте

Очевидно, что для обеспечения однозначности, с которой
мРНК
ко-

дирует
белки в процессе трансляции, аминоацил-тРНК-синтетазы

должны обладать исключительно высокой специфичностью в выборе

как
аминокислоты, так и
тРНК
в качестве субстратов. В
случае

выбора аминокислоты ферменту приходится дискриминировать меж-

ду субстратами, иногда очень близкими по
структуре

например,

45

между
изолейцином и валином. Уровень ошибок, которые допускает

фермент в аминоацилировании'
тРНК,
действительно, очень низок,

и
даже
в
случае
близких аминокислот (изолейцин

валин) он, по-

видимому, не превышает 1 на
10000.

Однако при изучении стадий связывания аминокислоты и после-

дующего
обратимого образования аминоациладенилата, регистрируе-

мого по АТФ-пирофосфатному обмену, оказалось, что- фермент не

может обеспечить столь высокой специфичности в дискриминации

близких аминокислот на этих стадиях. Так, изолейциновая амино-

ацил-тРНК-синтетаза может довольно эффективно связывать валин

и
образовывать валиладенилат. Точно так же валиновая аминоацил-

тРНК-синтетаза может связывать и активировать изолейцин, а также

аланин,
серии, цистеин и треонин. Фенилаланиновый фермент активи-

рует
метионин, лейцин и тирозин. Тем не менее, ни одна из

перечисленных ложноактивированных аминокислот не становится

акцептированной на тРНК.

Оказалось, что в дополнение к дискриминации аминокислот

на
стадии связывания фермент может обладать специальным
меха-

низмом коррекций ошибок, вступающим в действие после образова-

ния
аминоациладенилата. Основной факт состоит в том, что связы-

вание ферментом своей
тРНК
приводит к гидролитическому освобож-

дению свободной аминокислоты, если она была чужой для фермента.

По-видимому, в большинстве случаев ложноактивированная амино-

кислота, связанная с ферментом в виде аминоациладенилата, далее

нормально переносится на тРНК, но, в отличие от сложноэфирной

связи
между
своей аминокислотой и тРНК, связь
между
чужой

аминокислотой и
тРНК
гидролизуется ферментом:

Val + ATP + EUe .
Val-AMP

EIle
+ PP,;

Val-AMP

EIle
+
tRNAIle
.
Val-tRNAIU

EIle
+ AMP;

Val-tRNAUe

Elle
+ НЮ

Val +
tRNAlle
+
EIle

Это значит, что здесь фермент получает второй шанс дискрими-

нировать аминоацильные остатки, теперь уже в виде их сложно-

эфирных производных, и в
случае
чужого
остатка активирует молеку-

лу воды, которая атакует сложноэфирную связь. Показано, что в акти-

вации такого гидролиза валил-тРНК11е изолейцил-тРНК-синтетазой

существенную роль играет свободный З'-гидроксил рибозы тРНК.

Возможно, что в некоторых случаях не исключен и
другой

механизм коррекции, где чужой аминоациладенилат гидролизуется

ферментом до переноса аминоацильного остатка на тРНК.

Специфичность
по
отношению
к тРНК

Уже отмечалось, что связывание
тРНК
с аминоацил-тРНК-синтетазой

является многоступенчатым процессом. Первоначальное связывание

не очень специфично, так что фермент может взаимодействовать

с рядом
чужих
для него тРНК. Так, изолейциновая аминоацил-

46

тРНК-синтетаза может связывать тРНКУа1
,
причем
это
связывание

всего
в
5 раз слабее связывания своей тРНК11е
;
связывание
тРНК
Glu

тоже имеет место, хотя
оно уже в
10000
раз
слабее связывания

своей
тРНК
11е . В
целом,
для
разных комбинаций аминоацил-тРНК-

синтетаз
с
чужими
тРНК
обнаруживается самое разное сродство,

от почти полного отсутствия
до
сравнимого
со
сродством
к
своей

тРНК.
Сродство ферментов
к
тРНК,
как
правило, возрастает
с

уменьшением
pH и
солевой концентрации,
а
также
под
действием

органических растворителей,
что
указывает
на
значительную роль

ионных взаимодействий
в
связывании. Соответственно, уменьшение

pH,
уменьшение ионной силы

введение органических раство-

рителей
в
среду
способствуют неспецифическому связыванию
тРНК

аминоацил-тРНК-синтетазами. Однако Mg2+ часто оказывает проти-

воположное действие, понижая связывание
чужих
тРНК
с
амино-

ацил-тРНК-синтетазой,
т. е.
повышая специфичность связывания.

Последнее обычно приписывают эффекту Mg2+ на конформации
как

фермента,
так и
тРНК.

Стадия первоначального связывания
тРНК
с
ферментом быстра,

т. е. скорости
как
прямой,
так и
обратной реакции (ассоциации
и

диссоциации) высоки.
За
этой быстрой стадией первоначальной

рекомбинации может следовать медленная стадия какой-то пере-

стройки комплекса. Такая перестройка происходит только
в том слу-

чае, если связанная
тРНК
оказывается своей.
Это и
есть стадия

узнавания,
на
которой происходит основная дискриминация своих

и
чужих
тРНК. Таким образом,
на
первой стадии связывания проис-

ходит
только самый грубый, приблизительный отбор тРНК,
и в

основном
ее
функцией является быстрый перебор (сканирование)

разных тРНК. Если связанная
тРНК
оказывается чужой,
она не

активна
в
индуцировании структурной перестройки ферментного

комплекса,
а
следовательно,
не
может войти
в
следующую
стадию

и
потому диссоциирует
за
счет быстрой обратимости первоначаль-

ного комплекса. Только если связанная
тРНК
своя,
то
инициирует-

ся
следующая фаза связывания,
на
которой происходит
перестройка

комплекса
и подгонка
тРНК
для
осуществления последующей

реакции аминоацилирования:

быстро,

не
очень
медленно,

специфично специфично

Е

Аа-АМР + tRNA . £ (Е

Аа-АМР

tRNA)' •




Аа-АМР

tRNA)" • Е

Aa-tRNA
+
АМР

Возможно, однако,
что
этот механизм
не
универсален
для
всех

аминоацил-тРНК-синтетаз. Например, тирозиновая аминоацил-тРНК-

синтетаза Е.
coli и
сериновый фермент дрожжей,
а
также аргинил-

тРНК-синтетаза проявляют очень высокую специфичность
уже на

стадии первоначального комплекса, практически
не
связывая
чужих

тРНК.

Как
бы то ни
было,
в
конечном счете достигается очень высокая

специфичность выбора
тРНК
ферментом
для
реакции аминоацили-

47

рования.
Фермент так или иначе должен узнать свою
тРНК.
Очевидно,

что какие-то определенные участки молекулы тРНК служат для

этого опознания. Имеющиеся данные указывают, что такие участки

могут
находиться в нескольких, часто удаленных
друг
от
друга,

районах пространственной структуры
тРНК.
По-видимому, различные

аминоацил-тРНК-синтетазы используют разные районы тРНК для

узнавания. Так, метиониновая аминоацил-тРНК-синтетаза использует

для связывания и узнавания
тРНК
£*е1
как ее антикодон, так и акцеп-

торный черешок, а также дополнительную вариабельную петлю в

районе
«ядра»
молекулы. Вероятно, что именно одновременное

узнавание всех трех участков тРНК необходимо для ее точного

опознания
и конечной подгонки к ферменту. В
других
системах

аминоацил-тРНК-синтетеза/тРНК
в качестве узнаваемых районов

тРНК
также часто выявляются акцепторный черешок и антикодоновая

шпилька и иногда, кроме того, дигидроуридиловая спираль и допол-

нительная вариабельная петля. Общим для всех аминоацил-тРНК-

синтетаз является то, что узнаваемые ферментами районы тяготеют

к
внутренней стороне
угла
L-образной
тРНК.
Вероятнее всего, именно

внутренняя сторона
угла
L-образной тРНК и примыкающие к ней

участки обеих плоских сторон молекулы взаимодействуют с поверх-

ностями фермента.

Рекомендуемая
литература

Молекулы и клетки: Пер. с англ./Под ред. Г. М. Франка. М.: Мир, 1968. С. 77—91.

Нуклеиновые кислоты/Под ред. Э. Чаргаффа и Дж. Дэвидсона: Пер. с англ./Под

ред. А. Н. Белозерского. М.: ИЛ, 1962. С. 291-337.

Венкстерн Т. В. Первичная структура транспортных рибонуклеиновых кислот. М.:

Наука,
1970.

Киселев Л. Л.,
Фаворова
О. О., Лаврик О. И. Биосинтез белков от аминокислот

до
аминоацил-тРНК.
М.: Наука, 1984.

Шапвиль Ф„ Энни А.-Л. Биосинтез белка: Пер. с франц./Под ред. Л. Л. Киселева.

М.:
Мир, 1977.

Altman S., ed. Transfer RNA. Cambridge (Mass.): MIT Press, 1978.

Cohn
W. E., ed. Progress in Nucleic Acid Research and Molecular Biology. N. Y.:

Acad. Press, 1976, v. 17, p. 182-216; 1977, v. 20, p. 1-19; 1979, v. 22, p. 1-69;

1979, v. 23, p. 227-290.

Davidson
J. N..
Cohn
W. £., eds. Progress in Nucleic Acid Research and Molecular

Biology. N. Y.: Acad. Press, 1972, v. 12, p. 49-85; 87-128.

Schimmel Р., Soll D.,
Abelson
J., eds. Transfer RNA: Structure, Properties, Recognition.

N.
Y.: Cold Spring Harbor Laboratory, 1979.

Slonimski R,
Borst
R,
Attardi
G., eds. Mitochondrial Genes. N. Y": Cold Spring

Harbor
Laboratory, 1982.

Soll D.,
Abelson
J., Schimmel Р., eds. Transfer RNA: Biological Aspects. N. Y.: Cold

Spring Harbor Laboratory, 1980.

Weissbach H., Pestka S., eds. Molecular Mechanisms of Protein Biosynthesis. N. Y.:

Acad. Press, 1977, p. 7-79.

Alzhanova А. Т.,
Fedorov
A. N., Ovchinnikov L. Р., Spinn A. S. Eukaryotic aminoacyl-

tRNA
synthetases are RNA-binding proteins whereas prokaryotic ones are not. FEBS Lett.,

1980, v. 120, p. 225-229.

Dang
С V.,
Johnson
D. L., Yang D. С H. High molecular mass amino acyl-tRNA

synthetase complexes in eukaryotes. FEBS Lett, 1982, v. 142, p. 1-6.

Fersht
A. R. Editing mechanisms in protein synthesis. Rejection of valine by the

isoleucyURNA synthetase. - Biochemistry, 1977, v. 16, p. 1025-1030.

48

Gauss D. H„ Sprinzl M. Compilation of tRNA sequences. - Nucleic Äcids Res., 1983,

11,
р. П-Г53.

Hoagland M. В., Zamecnik Р. С
Stephenson
M. L.
Intermediate
reactions in
protein

biosynthesis.
-
Biochim.
Biophys.
Acta,
1957, v. 24, p. 215-216.

Kiselev L. L.,
Favorova
O. 0.
Aminoacyl-tRNA
synthetases: Some recent
results
and

achievements.
- Adv.
Enzym.,
1974, v. 40, p. 141-238.

Ogata H, Nohara H. The
possible
role
of the
ribonucleic
acid
(RNA) of the pH 5

enzyme
in
amino
acid
activation.
-
Biochim.
Biophys.
Acta,
1957, v. 25, p. 659-660.

Rieh A., RajBhandaty U. L.
Transfer
RNA: Molecular
strueture,
sequence
and pro-

perties. - Ann. Rev. Biochem., 1976, v. 45, p.
805-860.

Rieh A., Schimmel P. R.
Structural
organization
of complexes of
transfer
RNAs
with

aminoacyl
transfer
RNA synthetases. - Nucleic
Acids
Res., 1977, v. 4, p. 1649-1665.

Schimmel Р., Soll D.
Aminoacyl-tRNA
synthetases:
General
features
and
recognition

transfer
RNAs. - Ann. Rev. Biochem., 1979, v. 48, p. 601-648.

Глава IV.

РИБОСОМЫ И ТРАНСЛЯЦИЯ

1. ПЕРВЫЕ НАБЛЮДЕНИЯ

К
1940 г.
Альберту
Клоду (США) удалось выделить из животных

клеток цитоплазматические РНК-содержащие гранулы, более мелкие,

чем митохондрии и лизосомы (от 50 до 200 ммк в диаметре);

позднее он назвал их микросомами. Химические анализы указыва-

ли,
что микросомы Клода были «фосфолипидно-рибонуклеопротеид-

ными
комплексами». С другой стороны, цитохимические работы

Т. Касперсона (Швеция) и Ж. Браше (Бельгия) продемонстрировали

преимущественно цитоплазматическую локализацию РНК и корреля-

цию количества РНК в цитоплазме с интенсивностью белкового

синтеза.

После этого ряд исследователей время от времени сообщали о

выделении из цитоплазмы животных или растительных клеток, а

также из бактерий РНК-содержащих частиц, гораздо более мелких,

чем микросомы. Электронная микроскопия и седиментационный

анализ в ультрацентрифуге указывали, что частицы компактны,

более или менее сферичны и гомогенны по размеру, имея диаметр

10—20
нм и обнаруживая резкие седиментационные границы с

коэффициентами
седиментации от
30-40S
до 70—90S. Пожалуй, пер-

вое ясное свидетельство, что такие частицы бактерий являются

рибонуклеопротеидами, было получено Г. К. Шахманом, А. Б. Парди

и
Р. Станиером (США) в 1952 г.

Улучшенная техника микротомии и электронной микроскопии

ультратонких срезов животных клеток привела к выявлению одно-

родных плотных гранул с диаметром около 15 нм непосредственно

в клетке. Электронно-микроскопические исследования Дж. Паладе

(США),
проведенные в
1953—1955
гг., показали, что маленькие

плотные гранулы в изобилии содержатся в цитоплазме животных

клеток. Они видны либо присоединенными к мембране эндоплазма-

тического ретикулума, либо свободно рассеяны в цитоплазме.

49

Микросомы
Клода оказались фрагментами эндоплазматического

ретикулума с сидящими на них гранулами (Дж. Паладе и Ф. Сике-

виц,
1956). Выяснилось, что эти
«гранулы
Паладе» являются рибо-

нуклеопротеидными частицами и что они представляют основную

массу цитоплазматической РНК, обеспечивающей белковый синтез.

В
1956—1958
гг. в ряде лабораторий США были выделены и

изучены чистые препараты рибонуклеопротеидных частиц — сначала

80S частиц из дрожжей
Ф.-Ц.
Чао и Г. К. Шахманом, из растений

П.
Тсо, Дж. Боннером и Дж. Виноградом и из животных М. Петер-

манн
и М. Гамильтон, а затем 70S частиц из бактерий
(Е.
coli)

А. Тиссиером и Дж. Уотсоном. В 1958 г. состоялся первый Симпо-

зиум, посвященный этим частицам и их участию в биосинтезе

белка (Первый Симпозиум Биофизического Общества США при

Массачусеттском Технологическом Институте. Кэмбридж, февраль

5—8, 1958); в
ходе
Симпозиума Р. Б. Робертсом был предложен

термин «рибосома» для обозначения рассматриваемых рибонуклео-

протеидных частиц.

Исследования
функциональной роли рибосом шли параллельно

с их обнаружением и структурным описанием. Первой убедитель-

ной
демонстрацией того, что именно рибонуклеопротеидные части-

цы
микросом ответственны за включение аминокислот в новосинте-

зированный
белок, были эксперименты П. Замечника с сотрудниками

(США),
опубликованные в 1955 т. За этим последовали эксперимен-

ты из той же лаборатории, показавшие, что свободные рибосомы,

не
прикрепленные к мембранам эндоплазматического ретикулума,

также включают аминокислоты и синтезируют белок, освобождаю-

щийся
затем в растворимую фазу (1957). Функции бактериальных

рибосом были предметом интенсивных исследований группы

Р.
Б. Робертса (США); К. Мак Киллен, Р. Б. Роберте и Р. Дж. Бриттен

в
1959 г. окончательно установили, что белки синтезируются в

рибосомах и затем распределяются по другим частям бактериаль-

ной
клетки.

2.
ЛОКАЛИЗАЦИЯ
РИБОСОМ В
КЛЕТКЕ

Итак,
рибосомы обильно наполняют клетки, ведущие интенсивный

белковый синтез. В бактериальной клетке они рассеяны по всей

протоплазме, составляя до 30%, а иногда и более, ее
сухой

массы; на одну бактериальную клетку приходится
грубо
104 ри-

босом.

В эукариотических клетках относительное содержание (концентра-

ция)
рибосом меньше, и их количество очень сильно варьирует

в
зависимости от белоксинтезирующей активности соответствующей

ткани
или отдельной клетки. Основная масса рибосом локализо-

вана в цитоплазме (рис. 29). В клетках с интенсивной секрецией

белка и развитой сетью эндоплазматического ретикулума значитель-

ная
часть цитоплазматических рибосом прикреплена к его мембране

на
поверхности, обращенной к цитоплазматическому матриксу;

в
некоторых частях ретикулума их может быть много, в то время

50

Рис.
29.
Электронные микрофотографии рибосом на ультратонких срезах:

а —
участок цитоплазмы клетки печени
крысы
(предоставлена проф. Ю. С. Ченцовым, МГУ

им. М. В. Ломоносова). Видны рибосомы на мембранах шероховатого эндоплазматического

ретикулума, а также
группы
свободных рибосом. Фиксация глютаральдегидом; 6

клетки

морской бактерии Vibrio alginolyticus (предоставлена Л. Е. Бакеевой, МГУ им. М. В. Ломоносова).

Видно,
что цитоплазма наполнена рибосомами. Фиксация четырехокисью осмия

51

как
другие
остаются свободными. Эти рибосомы синтезируют белки,

которые непосредственно транспортируются в мембранный просвет

для дальнейшей секреции. Синтез белков для внутриклеточных

нужд
происходит в основном на
«свободных»
(не связанных с мембра-

ной,
а рассеянных в цитоплазматическом матриксе) рибосомах

цитоплазмы.
Поэтому цитоплазма эмбриональных, недифференциро-

ванных, быстро растущих и размножающихся клеток содержит

преимущественно свободные рибосомы.

Все рибосомы цитоплазматического матрикса (как мембрано-

связанные,
так и свободные) образуются в ядрышке эукариотиче-

ской
клетки и соответственно обнаруживаются также в этом ком-

партменте клеточного ядра; считается, что в ядрышке они не

активны.

Кроме
того, эукариотическая клетка имеет специальные рибосомы

в
таких внутриклеточных органеллах, как митохондрии и, в
случае

растений,
хлорпласты. Рибосомы этих органелл отличаются от

цитоплазматических рибосом слегка меньшими размерами, другим

химическим составом и некоторыми функциональными свойствами.

Они
образуются непосредственно в органеллах.

3.
ПРОКАРИОТИЧЕСКИЙИ
ЭУКАРИОТИЧЕСКИЙ

ТИПЫ
РИБОСОМ

Имеется
два главных типа рибосом в живой природе (рис. 30).

Всем прокариотическим организмам, включая грамположительные

и
грамотрицательные эубактерии, актиномицеты и синезеленые

водоросли, а также архебактерии (метабактерии), свойственны

70S рибосомы. Они, соответственно, характеризуются седиментацион-

ным
коэффициентом около 70S. Их молекулярная масса составляет

около
2,5

10е дальтон, а линейные размеры (средний диаметр)

в
лиофильно-высушенним состоянии около
20—25
нм. По химиче-

скому составу они
--
чистые рибонуклеопротеиды, т. е. состоят

только из РНК и белка.

Соотношение
масс РНК: белок в них около 2:1; соответ-

ственно,
парциальный удельный объем 70S рибосом около 0,60 см3/г,

а плавучая плотность в CsCl 1,64 г/см3. РНК в рибосомах при-

сутствует
главным образом в виде ее Mg2+-, и, по-видимому,

частично Са2+-соли; Mg составляет до 2%
сухой
массы рибосом.

Кроме
того, в варьирующих количествах (до 2,5%
сухой
массы)

могут
присутствовать также органические
катионы,
такие как спермин,

спермидин,
кадаверин и путресцин. Количество связанной воды в

70S рибосомах относительно невелико и составляет около 1 г/г,

т. е. рибосомы в водной среде
суть
довольно компактные, не

разбухшие частицы.

Морфологически
все 70S рибосомы прокариотических организмов

поразительно универсальны, и лишь у рибосомных частиц архе-

бактерии (метабактерии) можно обнаружить некоторые отличия от

эубактериальных частиц (см.
следующую
часть
книги).

Цитоплазма клеток
всех
эукариотических организмов, включая

52

МОЛ. МАССА,

дальтон

РАЗМЕР

РНК
:
БЕЛОК

весовое

соотношение
ПРОКАРИОТИЧЕСКИЙ

ТИП

70S РИБОСОМЫ

ЭУБАКТЕРИЙ,

СИНЕ ЗЕЛЕНЫХ

ВОДОРОСЛЕЙ
И

ХЛОРОПЛАСТОВ

2,5-106

20-25НМ

2
: 1

70S РИБОСОМЫ

АРХЕБАКТЕРИЙ

(МЕТАБАКТЕРИЙ)

МИТОХОНДРИАЛЬНЫЕ

75S РИБОСОМЫ

ГРИБОВ

МИТОХОНДРИАЛЬНЫЕ

55S РИБОСОМЫ

("МИНИРИБОСОМЫ")

МЛЕКОПИТАЮЩИХ
ЭУКАРИОТИЧЕСКИЙ
ТИП

ЦИТОПЛАЗМАТИЧЕСКИЕ
80S

РИБОСОМЫ ЖИВОТНЫХ,

ГРИБОВ
И

РАСТЕНИЙ

4 «106

25-30
НМ

1
: 1

Рис.
30.
Прокариотический
и
эукариотический
типы
рибосом.

животных, грибы, растения и простейших, содержит несколько

более крупные 80S рибосомы. Их молекулярная масса составляет

около
4 • 10е дальтон, а линейные размеры от 25 до 30 нм (в

лиофильно-высушенном состоянии). Они также включают только два

типа биополимеров —
РНК
и белок, но содержание белка в них

существенно больше, чем в прокариотических рибосомах; соотноше-

ние
масс РНК: белок около 1 :1, парциальный удельный объем око-

ло 0,65 смэ/г и плавучая плотность в CsCl
1,55—1,59
г/см3. Важно

отметить, что абсолютное количество как РНК, так и белка (а не

только пропорция белка) в 80S рибосомах существенно больше, чем

в
70S рибосомах. Рибосомная РНК 80S рибосом также связана, в

основном,
с такими двувалентными катионами, как Mg2+ и Са2+,

а также с небольшим количеством полиаминов и диаминов (спермин,

спермидин,
путресцин).

Поразительная
универсальность морфологии
всех
80S рибосом,

53

независимо
от их
принадлежности
тому
или
другому
царству

эукариот, должна быть также отмечена.

Однако хлоропласты
и
митохондрии эукариотических клеток

содержат
рибосомы, отличные
от 80S
типа. Рибосомы хлоропластов

высших растений принадлежат
к
истинному
70S
типу
и
практически

не
отличимы
от
рибосом эубактерий
и
синезеленых водорослей
по

вышеприведенным показателям
и по
более детальным молекулярным

характеристикам. Митохондриальные рибосомы более разнообразны

в
зависимости
от
принадлежности организма
к
тому
или
иному

царству эукариот. Наиболее изучены рибосомы митохондрий грибов

и
млекопитающих. Митохондриальные рибосомы грибов
(Saccharomyces,

Neurospora)
похожи
на
прокариотические
70S
рибосомы,
но,
может

быть, лишь слегка крупнее (около
75S) и
содержат
относительно

больше белка; абсолютное содержание рибосомной РНК
в них, по-

видимому, почти такое
же, как в
типичных
70S
рибосомах. Мито-

хондриальные рибосомы млекопитающих, однако, существенно мельче

типичных
70S
рибосом, имея также
и
существенно меньшее абсолют-

ное
количество рибосомной
РНК на
частицу;
их
иногда называют

«мини-рибосомами». Действительно, коэффициент седиментации

рибосом
из
митохондрий млекопитающих составляет всего около

55S,
а
тотальная масса рибосомной
РНК на
частицу более
чем на

1/3
меньше,
чем в
типичных
70S
рибосомах.
В то же
время,
ми-

тохондриальные рибосомы млекопитающих
содержат
довольно

много белка,
так что
общие размеры
их как
будто
бы не
сильно

отличаются
от
таковых прокариотических рибосом.
В
целом,
не-

смотря
на ряд
необычных
черт,
по
ряду
своих признаков,
и в том

числе
по
функциональному поведению, митохондриальные рибосомы

млекопитающих
все же
близки
к
прокариотическим
70S
рибосомам.

4.
ПОСЛЕДОВАТЕЛЬНОЕ
СЧИТЫВАНИЕ

мРНК
РИБОСОМАМИ.
ПОЛИРИБОСОМЫ

В процессе белкового синтеза рибосома каждый
раз
связана лишь

с ограниченным отрезком матричного полинуклеотида
(мРНК).
Так

как
отрезки матричного полинуклеотида, непосредственно связанные

с рибосомами, оказываются защищенными
от
действия нуклеаз,
они

могут
быть выделены после нуклеазной обработки комплексов

рибосома • матрица. Длина таких отрезков была найдена равной
от

20
до 60
нуклеотидных остатков.
В то же
время, длина кодирующей

последовательности
мРНК
обычно превосходит
300
нуклеотидных

остатков.
Отсюда
давно стало очевидно,
что для
считывания всей

кодирующей последовательности
мРНК
рибосома должна
последова-

тельно пройти (или, что то же
самое, последовательно протащить

через себя) матрицу,
от
5'-концевой части кодирующей последова-

тельности
до ее
3 -концевой части. Другими словами, рибосома

должна работать как лентопротяжный механизм.

Какова
же
скорость движения рибосомы вдоль информацион-

ной
РНК?
В
бактериальной клетке, например, Е.
coli,
белок разме-

ром около
300
аминокислотных остатков, синтезируется приблизи-

54

ЭЛОНГАЦИЯ

мРНК

ПОЛИРИБОСОМА

-\
^-\ Г~\ ^ У^ I
ЗАВЕРШЕННЫЙ

v4
ü CJ О *
БЕЛ0К

о
о

СВОБОДНЫЕ РИБОСОМЫ

Рис.
31. Схема полирибосомы

тельно
за
двадцать секунд
(при
37°С).
Это
значит,
что
рибосома

пробегает приблизительно
40—50
нуклеотидных остатков
мРНК
в

секунду. Скорость считывания
мРНК
у
эукариот может достигать

близкого значения
(30
нуклеотидов
в
секунду),
но
регуляторные

воздействия
могут
уменьшить
ее до
3—10 нуклеотидов
в
секунду (см.

гл. В. V).

Продвигаясь вдоль матричного полинуклеотида
от
5'-конца
к 3'-

концу,
рибосома через какое-то время освободит 5'-концевой участок

матрицы.
Тогда этот участок может начать считывать
другая
рибо-

сома. Так
же
отойдя
от
5'-концевой части, она предоставит возмож-

ность начать считывание третьей рибосоме.
И так
далее. Так,
идя

вдоль матрицы
друг
за другом, ряд рибосом оказываются читающими

одну
и ту же
информацию и, следовательно, синтезирующими иден-

тичные полипептидные цепи,
но
находящимися
на
разных стадиях

формирования
полипептида.
Это
схематически представлено
на

рис.
31, где
рибосомы
у
З'-конца матрицы
уже
нарастили длинный,

почти завершенный полипептид, рибосомы
в
середине несут поли-

пептид
в
половину
его
запрограммированной длины,
и
рибосомы
у

5'-конца содержат лишь короткие пептиды,
в
самом начале
их

удлинения. Такая
структура,
где
матричный полинуклеотид ассоции-

рован
со
многими транслирующими рибосомами, получила название

полирибосомы.

То,
что рибонуклеопротеидные гранулы (рибосомы)
не
равномер-

но
диспергированы
в
цитоплазме животных клеток или
в
препарате

частиц, полученных
из
микросом,
а
часто собраны
в
группы (цепи

или
кластеры), было отмечено
еще в
ранних электронно-микроскопи-

ческих наблюдениях Дж. Паладе и др. Доказательство того, что такие

агрегаты рибосом представляют собой частицы, соединенные цепью

мРНК
и
находящиеся
в
процессе трансляции, были представлены

одновременно несколькими группами
в
1963
г.

При
интенсивном белковом синтезе расстояние
между
рибосомами

вдоль цепи
мРНК
в
полирибосоме может быть предельно коротким,

так
что
рибосомы
будут
находиться почти вплотную
друг
к
другу.

Другими словами,
на
каждую рибосому может приходиться всего

от
20 до 60
нуклеотидных остатков. Это значит, что приблизительно

каждую секунду одна рибосома
будет
завершать синтез белка
у

55

3'-конца кодирующей части
мРНК
и соскакивать с матрицы, и одна

рибосома
будет
садиться на матрицу у 5'-конца и начинать движение

по
направлению к З'-концу.

Открытие полирибосом как формы существования транслирующих

рибосом в клетке сделало понятным тот факт, что рибосом в клетке

много,
а
мРНК
мало. Действительно, часто приводят цифры, что

рибосомная
РНК составляет 80% тотальной РНК клетки, а
мРНК,
как

правило,
не более 5%. В
свете
полирибосомной организации трансли-

рующего
аппарата это понятно: одну
мРНК
транслирует много рибо-

сом,
так что на одну часть транслируемой
мРНК
может приходиться

до
100—200
частей рибосомной РНК.

5.
СТАДИИ
ТРАНСЛЯЦИИ:
ИНИЦИАЦИЯ,

ЭЛОНГАЦИЯ
И
ТЕРМИНАЦИЯ

Рибосома начинает читать
мРНК
со строго определенной точки ее

последовательности, а именно с той, с которой начинается ее коди-

рующая часть. Как уже отмечалось, эта точка вовсе не есть самый

крайний
5'-концевой нуклеотид
мРНК,
а как правило, расположена на

определенном удалении, иногда значительном, от начала полинуклео-

тидной цепи. Рибосома должна каким-то образом узнать начальную

точку считывания, связаться с ней, и только
тогда
начать трансля-

цию.
Комплекс событий, обеспечивающих процесс начала трансля-

ции,
обозначается как стадия
инициации.
В инициации принимают

участие
специальный инициаторный кодон, инициаторная
тРНК
и

белки,
называемые факторами инициации.

Пройдя
стадию
инициации,
рибосома
переходит
к последователь-

ному прочтению кодонов
мРНК
по направлению
к
З'-концу.
Прочтение

мРНК
предполагает последовательный синтез полипептидной цепи

белка, кодируемого
мРНК.
Синтез происходит на рибосоме
путем

последовательного добавления одного аминокислотного остатка за

другим
к строящейся полипептидной цепи; таким
путем
осуществля-

ется элонгация пептида. Каждый новый аминокислотный остаток

добавляется к карбоксильному концу (С-концу) пептида, т. е. С-конец

пептида является растущим. Добавление одного аминокислотного

остатка
соответствует
прочтению одного нуклеотидного триплета.

Весь этот процесс собственно трансляции кодирующей части
мРНК

называют стадией
элонгации.

Когда рибосома достигнет терминирующего кодона
мРНК,
синтез

полипептида прекращается. В присутствии терминирующего кодона

рибосома не связывает какой-либо аминоацил-тРНК, а вместо них в

дело
вступают
специальные белки, называемые факторами термина-

ции.
Под их действием синтезированный полипептид освобождается

из
рибосомы. Эта стадия называется
терминацией
трансляции. После

терминации
рибосома может либо сойти с
мРНК,
либо продолжать

скользить вдоль нее, не транслируя.

Встреча
рибосомы с новым
инициаторным
кодоном,
либо на
другой

цепи
мРНК,
либо на этой же по направлению к З'-концу от терми-

нирующего кодона, приведет к новой инициации. Таким образом,

56

каждая рибосома проходит полный цикл трансляции, включающий

инициацию,
элонгацию и терминацию; в
результате
такого эпицикла

прочитывается вся кодирующая последовательность
мРНК
и синтези-

руется
законченная полипептидная цепь белка (рис. 31). После этого

рибосома может повторить цикл с
другой
цепью
мРНК
или
другой

кодирующей последовательностью той же цепи.

6.
БЕСКЛЕТОЧНЫЕ
СИСТЕМЫ
ТРАНСЛЯЦИИ

Синтез
белка на рибосомах может быть воспроизведен в искусст-

венных условиях вне клетки. Включение аминокислот в белки в гомо-

генатах
и экстрактах клетки, а также препаратами микросом в бескле-

точных системах было продемонстрировано уже давно; пожалуй,

первыми были бесклеточные системы из животных тканей, и, в част-

ности,
из печени крысы, о которых сообщили Ф. Сикевиц и П. Замеч-

ник
(США) в 1951 г. и П. Замечник в 1953 г. Вскоре после этого

было показано, что включение аминокислот (синтез белка) в бескле-

точной системе происходит на рибонуклеопротеидных частицах

(рибосомах). Бесклеточные системы синтеза белка с бактериальными

(Е.
coli)
рибосомами были созданы почти одновременно Д Шахтша-

белом и В. Циллигом
(ФРГ),
М Ламборг и П. Замечником (США)

и
А. Тиссиером, Д. Шлессингером и
Ф.
Гро (США) в
1959-1960
гг.

Все эти системы были основаны на трансляции своей эндогенной

матрицы;
фактически рибосомы лишь продолжали синтез полипеп-

тидов на
мРНК,
к которым они уже были присоединены в момент

выделения. Г. Маттей и М. Ниренберг в 1961 г.
улучшили
систему;

освободили рибосомы от эндогенных матриц и впервые ввели экзоген-

ную матрицу в бесклеточную рибосомную систему; одним из их глав-

ных достижений было использование синтетических полинуклеоти-

дов, получаемых с помощью полинуклеотидфосфорилазы, в том числе

простых матриц типа поли(11), поли(А) и др.

В настоящее время бесклеточная система синтеза белков может

быть составлена из хорошо охарактеризованных, высокоочищенных

компонентов,
включая рибосомы, матричный полинуклеотид и набор

аминоацил-тРНК
или систему ацилирования
тРНК
(тРНК,
аминокис-

лоты, АТФ и аминоацил-тРНК-синтетазы), а также набор специаль-

ных белков, называемых факторами трансляции, и ГТФ. Простейшая

бесклеточная рибосомная система синтеза полипептида, на которой

могут
изучаться принципиальные механизмы трансляции, включа.ет

всего 6 высокомолекулярных компонентов плюс ГТФ; например,

поли(и)-направляемая
система может быть составлена из:

7OS
рибосом
Е.
coli

Poly(U)

Phe-tRNA

EF-Ty
(белок
с мол.
массой
47000)

EF-TS
(белок
с мол.
массой
34000)

EF-G
(белок
с мол.
массой
83000)

GTP

57

Для трансляции природных матриц и вирусных РНК бесклеточная

прокариотическая система должна быть дополнена полным набором

аминоацил-тРНК,
тремя белками, необходимыми для инициации

трансляции
(IF-1,
IF-2 и
IF-3),
и тремя белками, нужными для терми-

нации
трансляции
(RF-1,
RF-2 и RF-3).

В случае использования эукариотических 80S рибосом для трансля-

ции
в бесклеточной системе все соответствующие белковые факторы

должны быть также эукариотического происхождения. Это два

фактора элонгации EF-1 и EF-2 (вместо EF-TU, EF-TS и
EF-G),

многочисленный набор факторов инициации
(eIF-1,
eIF-2,
eIF-3,

eIF-4A, eIF-4B, eIF-4C, eIF-4D, eIF-4E, eIF-4F, eIF-5) и один высоко-

молекулярный фактор терминации (eRF). Для инициации в эукарио-

тических системах требуется также АТФ.

Важным условием для бесклеточной системы является ионная

среда, и в первую очередь надлежащая концентрация ионов магния.

Обычный интервал концентраций Mg2+, в котором работают рибосомы

в бесклеточной системе, от 3 мМ до 20 мМ; оптимум лежит где-то

между этими значениями и зависит от рибосом и концентрации одно-

валентного катиона (К+или NH}), а также от температуры инкубации.

Основные факты, касающиеся трансляции и ее молекулярных ме-

ханизмов, были получены и получаются в настоящее время на бескле-

точных системах.

Рекомендуемая
литература

Биосинтез белка и его регуляция: Пер. с англ./Под ред. Я. М. Варшавского.—М.:

Мир,
1967. С. 9-32; 50-60; 160-193.

Живая клетка: Пер. с англ./Под ред. Г. М. Франка.-М.: Мир, 1966. С. 219-237.

Структура и функция клетки: Пер. с англ./Под ред. Г. М. Франка. М.: Мир,

1964. С. 197-215.

Питерман М. Физические и химические свойства рибосом: Пер. с англ./Под ред.

Е. Ф. Романцева.

М.: Мир, 1967.

Спирин
А. С, Гаврияова Л. П. Рибосома. - М: Наука, 1971.

Bielka H., ed. The Eukaryotic Ribosome. Berlin: Akademie-Verlag, 1982.

Nomura M.,
Tissiires
A., Lengyel Р., eds. Ribosomes. N. Y.: Cold Spring Harbor

Laboratory, 1974, p. 3-12; 13-52.

Roberts
R. В., ed. Microsomal Particles and Protein Synthesis. Ist Symp. of the

Biophysical Society, the Massachusetts Institute of Technology, Cambridge (Mass.), Februar}' 5,

6 and 8, 1958. London, New
York,
Paris, Los Angeles: Pergamon Press.

Brächet J. La localisation des acides pentosenucleiques dans les tissues animaux et

les oeufs
d'amphibiens
ел voie de ddvelopement. - Arch. Biol., 1942, v. 53, p. 207-257.

Casperson
T. Studien über den Eiweissumsatz der Zelle. - Naturwissenschaften, 1941,

v. 29, p. 33-43. •

Chao F.-C Schachman H. К The isolation and characterization of a macromolecular

ribonucleoprotein
from yeast. - Arch. Biochem. Biophys., 1959, v. 61, p. 220-230.

Claude
A. Particulate components of normal and tumor cells. - Science, 1940, v. 91,

p.
77-78.

Gierer
A. Function of aggregated reticulocyte ribosomes in protein synthesis. - J. Mol.

Biol., 1963, v. 6, p. 148-157.

Lamborg M., Zamecnik Р. С Amino acid incorporation by extracts of E.
coli.
- Biochim.

Biophys. Acta, 1960, v. 42, p. 206-211.

Littlefleld
J. W.,
Keller
E. B. Incorporation of O« amino acids into ribonucleoprotein

particles from the Ehrlich mouse ascites tumor. - J. Biol. Chem., 1957, v. 224, p. 13-30.

Littlefleld
J. W.,
Keller
E. В.,
Gross
J., Zamecnik Р. С Studies on cytoplasmic

ribonucleoprotein particles from the liver of the rat. - J. Biol. Chem., 4955, v. 217,

p.
111-123.

58

Matthaei H., Nirenberg M. W. The
dependence
of cell-free
protein
synthesis in E. coli

upon
RNA
prepared
from
ribosomes. - Biochem. Biophys. Res.
Commun.,
1961 v. 4

p. 184-189.

McQuillen K., Roberts R- В., Britten R. J. Synthesis of nascent
protein
by
ribosomes

in Escherichia
coli.
- Proc. Nat.
Acad.
Sei. U.S.A., 1959, v. 45, p. 1437-1447.

Nirenberg Al. W., Matthaei J. H. The
dependence
of cell-free
protein
synthesis in

E. coli
upon
naturally
oecurring
or synthetic polynucleotides. - Proc. Nat.
Acad.
Sei.

U.S.A., 1961, v. 47, p. 1588-1602.

Palade
G. E. A
small
particulate
component
of the cytoplasm. - J. Biophys. Biochem.

Cytol., 1955, v. 1, p.
59-68.

Palade
G. E., Siekevitz P.
Liver
microsomes. - J. Biophys. Biochem. Cytol., 1956, v. 2,

p. 171-200.

Penman S., Scherrer K., Becker Y., Darnell J. Polyribosomes in
normal
and
poliovirus-

infected
HeLa cells and
their
relationship
to messenger-RNA. - Proc. Nat.
Acad.
Sei. U.S.A.,

1963,
v. 49, p. 654-662.

Petermann U. L., Hamilton M. G. The
purification
and
properties
of cytoplasmic

ribonucleoprotein
from
rat
liver.
- J. Biol.
Chem.,
1957, v. 224, p. 725-736.

Schachman H. K, Pardee А. В., Stanier R. Y. Studies on the
macromolecular
orga-

nization
of
microbial
cells. -
Arch.
Biochem. Biophys., 1952, v. 38, p. 245-260.

Schachtschabel D., Zillig W.
Untersuhungen
zur Biosynthese der Proteine. I. Über den

Einbau '«C-markierter Aminosäuren ins Protein zellfreier Nucleoproteid-Enzym-Systeme aus

Escherichia
coli B. - Hoppe Seyler's Z. Physiol. Chem., 1959, v. 314, p. 262-275.

Siekevitz Р., Zamecnik Р. С In
vitro
incorporation
of l-C'-DL-alanine into
proteins

of
rat-liver
granulär fractions. - Fed. Proc, 1951, v. 10, p. 246.

Tissieres A„ Watson J. D. Ribonucleoprotein particles from
Escherichia
coli. - Nature,

1958,
v. 182, p. 778-780.

Tissieres A., Schlessinger D., Gros F. Amino aeid incorporation into proteins by

E.
coli ribosomes. - Proc. Nat. Acad. Sei. U.S.A., 1960, v. 46, p. 1450-1463.

Ts'o P.O.P., Bonner }., Vinograd J. Microsomal nucleoprotein particles from pea

seedlings. - J. Biophys. Biochem. Cytol., 1956, v. 2, p. 451-465.

Warner J. R., Knopf P. M., Rieh A. A multiple ribosomal strueture in protein

synthesis. - Proc. Nat. Acad. Sei. U.S.A., 1963, v. 49, p. 122-129.

Watson J. D. The involvement of RNA in the synthesis of proteins. - Science, 1963,

v. 140, p. 17-26.

Wettstein F. O., Staehelin Т., Noll H.
Ribosomal
aggregate
engaged
in
protein
synthesis:

characterization of the ergosome. - Nature, 1963, v. 197, p. 430-435.

Zamecnik Р. С
Incorporation
of
radioactivity
from
D,
L-leucine-l-'*C
into
proteins
of

rat
liver
homogenates. - Fed. Proc, 1953, v. 12, p. 295.

Zamecnik P. C, Keller E. B. Relation
between
phosphate
energy
donors
and
incorpora-

tion of
labeled
amino
acids into proteins. - J. Biol.
Chem.,
1954, v. 209, p. 337-354.

Глава
V.

ХИМИЧЕСКИЕ РЕАКЦИИ

И ОБЩИЙ ЭНЕРГЕТИЧЕСКИЙ
БАЛАНС

БИОСИНТЕЗА
БЕЛКА

Итак,
белок синтезируется из
аминокислот
путем
трех
последова-

тельных
химических
реакций.
Первые
две
реакции
катализируются

аминоацил-тРНК-синтетазами,
а третья,
завершающая,
—рибосомой:

(1)
Аа + ATP ARS'ase. Аа-АМР + РР,;

(2)
Аа-АМР + tRNA
ARS~as Аа - tRNA + АМР;

(3)
Aa-tRNA
+
X-Aa'-tRNA'
—ю >
X-Aa'-Aa-tRNA
+ tRNA'

59

В первой реакции карбоксил аминокислоты реагирует с полифосфат-

ной
группой АТФ, так что пирофосфатный остаток замещается на

аминоацильный и образует
смешанный
ангидрид,
называемый амино-

ациладенилатом. Во второй реакции
тРНК
замещает аденилатный оста-

ток, и образуется
сложноэфирная
связь
между
карбоксильной группой

аминокислотного остатка и гидроксилом рибозы концевого нуклеозида

тРНК.
Третья реакция, катализируемая рибосомой, представляет собой

замещение остатка
тРНК
(tRNA') остатком аминоацил-тРНК, в ре-

зультате
чего вместо сложноэфирной связи образуется
амидная

(пептидная)
связь
между
аминогруппой аминоацильного остатка мо-

лекулы аминоацил-тРНК и карбоксильной группой
другого
амино-

ацильного остатка (Аа'). Если конечный белок состоит из п амино-

кислотных остатков, то общий баланс реакций
будет
следующим:

ARS-as»,
tRNAs,
RS,

„Амр
+

рр.

Кроме того, в естественных условиях пирофосфат гидролизуется

пирофосфатазой до ортофосфата:

л РР, + л НгО • 2л Р,

Свободная энергия гидролиза пирофосфатных связей АТФ в стан-

дартных условиях
(AG0')
составляет около -30 кДж/моль (-7


-8 ккал/моль). Тот же знак и то же значение свободной энергии

гидролиза в стандартных условиях характерны для ангидридной связи

аминоациладенилата и сложноэфирной связи аминоацил-тРНК. Сво-

бодная энергия гидролиза пептидной связи бесконечно длинного

полипептида (белка) в стандартных условиях равна всего около

-2 кДж/моль (-0,5 ккал/моль). Следовательно, весь процесс идет

с освобождением большого количества свободной энергии, т. е. яв-

ляется термодинамически спонтанным и энергетически обеспеченным:

л Аа + и АТР

Белок
+ л АМР + л РР, - л X 30 кДж

Если добавить сюда еще и гидролиз пирофосфата, то общий
энер-

гетический баланс
будет
-лХбО
кДж на 1 моль белка. Таким об-

разом, при размере белка около 200 аминокислотных остатков выигрыш

свободной энергии (в стандартных условиях) составит около

12000
кДж/моль
(3000
ккал/моль).

Из
рассмотрения энергетического баланса вышеуказанных
трех

реакций в отдельности видно, что первые две реакции сами по себе

не
дают
выигрыша свободной энергии (в стандартных условиях) и,

следовательно, дорибосомные этапы не должны протекать с большим

сдвигом в сторону синтеза; однако сдвиг
будет
генерироваться при

условии, если пирофосфат гидролизуется в параллельной реакции.

Основной перепад в уровнях свободной энергии
между
субстратами

и
продуктами наблюдается именно в третьей реакции, т. е. сдвиг

суммарной реакции в сторону синтеза практически в любых условиях

обеспечивается рибосомным этапом.

Самое поразительное, однако, состоит в том, что, несмотря на

полную энергетическую обеспеченность процесса биосинтеза белка

из
свободных аминокислот за счет АТФ или из аминоацил-тРНК

60

за счет их сложноэфирных связей, на рибосомном этапе синтеза

гидролизуются еще две молекулы ГТФ на каждый аминокислотный

остаток:

2л GTP + 2л НЮ

2л GDP + 2л Р,

Это
дает
рибосомному этапу (и, следовательно, всему процессу)

дополнительный выигрыш свободной энергии около 60 кДж (15 ккал)

на
1 моль аминокислоты (в стандартных условиях).

Таким образом,
сумму
всех
химических реакций в биосинтезе

белка
следует
записать так:

лАа+
nATP
+
2nGTP
+ Зл Н2О ARS-ases' tRNAs' ^
Белок
+ л АМР + 2л GDP + 4л Р,;

общий энергетический баланс этой суммарной реакции До0' составит

около —120 кДж (—30 ккал) на 1 моль аминокислоты или
—25000
кДж

(-6000
ккал) на 1 моль белка длиной 200 аминокислотных остатков.

Однако в этом расчете была учтена только химическая сторона

процесса. Важно посмотреть, насколько данная оценка может из-

мениться, если
учесть
энтропийный проигрыш за счет упорядочен-

ного расположения аминокислотных остатков вдоль цепи синтези-

руемого белка, а также за счет фиксированной пространственной

структуры белка. Оказывается,
учет
детерминированного расположения

аминокислотных остатков в полипептидной цепи вносит сравнительно

небольшую поправку

около +10 кДж (+2,5 ккал) на моль амино-

кислоты. Что касается энтропийного фактора за счет упорядочения

пространственной структуры синтезируемого полипептида, то здесь

энтропийный
проигрыш (понижение энтропии) более существен, но он

компенсируется энтальпииным выигрышем в
результате
нековалентных

взаимодействий аминокислотных остатков. Таким образом, в любом

случае
синтез белка сопровождается диссипацией большого коли-

чества свободной энергии.

Смысл затраты такого большого
избытка
энергии представляет

собой одну из загадок и интереснейших проблем молекулярной

биологии. Избыток энергии, диссипируемый в теплоту и не исполь-

зуемый для совершения какой бы то ни было накапливаемой по-

лезной работы (в виде химических связей или небёспорядочного

расположения остатков), должен играть какую-то важную роль в

функционировании
белоксинтезирующей системы. Довольно очевидно,

что, во всяком случае, этот избыток энергии необходим для обеспе-

чения
высоких скоростей и высокой надежности синтеза белка.

Рекомендуемая
литература

Четверим
А. Б.,
Спирин
А. С.
Биоэнергетика
и
синтез
белка.

Успехи
биол.
химии,

1983. Т.
XXIV.
С. 3-39.

Cohn
W. E., ed.
Progress
in
Nucleic
Acid
Research
and
Molecular
Biology.
N. Y.:

Acad.
Press,
1978, v. 21, p. 39-62.
X